2013-05-20T03:51:31Zhttp://www.ncbi.nlm.nih.gov/oai/oai.cgioai:pubmedcentral.nih.gov:30394112011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30394112135066110.4061/2011/492875Research ArticlePlacing the RPL32 Promoter Upstream of a Second Promoter Results in a Strongly Increased Number of Stably Transfected Mammalian Cell Lines That Display High Protein Expression LevelsHoeksemaF.HamerK.SiepM.VerheesJ. A.OtteA. P.*Swammerdam Institute for Life Sciences, University of Amsterdam, Science Park 904, 1098 XH Amsterdam, The Netherlands*A. P. Otte: arie.otte@science.uva.nl
The use of high stringency selection systems commonly results in a strongly diminished number of stably transfected mammalian cell lines. Here we placed twelve different promoters upstream of an adjacent primary promoter and tested whether this might result in an increased number of colonies; this is in the context of a stringent selection system. We found that only the promoter of the human ribosomal protein, RPL32, induced a high number of colonies in CHO-DG44 cells. This phenomenon was observed when the RPL32 promoter was combined with the CMV, SV40, EF1-α, and the β-actin promoters. In addition, these colonies displayed high protein expression levels. The RPL32 promoter had to be functionally intact, since the deletion of a small region upstream of the transcription start site demolished its positive action. We conclude that adding the RPL32 promoter to an expression cassette in cis may be a powerful tool to augment gene expression levels.
1. Introduction
Several approaches have been described that positively influence gene expression levels. One typical approach is to flank a gene expression cassette with DNA elements that somehow augment gene expression levels. Amongst these elements are MAR (Matrix Attachment Regions) elements [1–3], UCOEs (Ubiquitous Chromatin Opening Elements) [4, 5], insulators [6, 7], and STAR elements [8]. In varying degrees such elements convey higher protein expression levels in transfected mammalian cell cultures [2, 3, 5, 8]. One approach is missing from this list: the use of a heterologous promoter that is combined with the promoter that normally drives gene expression in the expression cassette. In principle there is not much to say for such an approach. Placing two promoters adjacent to each other will often result in unwanted effects such as promoter interference, which refers to the direct negative impact of one transcriptional activity on a second transcriptional activity in cis [9]. Elaborate studies show the decline of promoter activities due to these phenomena [10–14]. However, some studies show a positive interaction among promoters. For instance, introducing an active promoter upstream of the silent human endogenous retrovirus (HERV)-K18 promoter activates its transcription in cis [15]. In addition, in case of integrated HIV-1 genomes within actively transcribed host genes in latently infected CD4+ T cells, read-through transcription-enhanced HIV-1 gene expression occurs when HIV-1 was in the same orientation as the host gene [16]. Furthermore, UCOEs are CpG island fragments containing two divergent promoters. When these elements are placed upstream of the hCMV promoter in mammalian cells, genomic locus silencing was reduced and transgene expression was enhanced [5].
Here we tested an array of twelve promoters and placed these immediately upstream of the human β-actin promoter. We did this in the context of a very stringent selection system for mammalian cells that we described previously. That system is based on the altered translation efficiency of the Zeocin-resistance selection marker [17–19]. For instance, the TTG Zeocin marker has a strongly impaired translation efficiency, as compared to the wild-type ATG Zeocin marker. For the cell to survive, sufficient Zeocin resistance protein is needed, and thus high levels of TTG Zeocin mRNA are needed to fulfil this requirement. When the TTG Zeocin gene is coupled to a gene of interest in such a way that a bicistronic mRNA is created, the high levels of this bicistronic mRNA will automatically result in high levels of the protein of interest. Importantly, DNA elements that augment gene expression are needed to induce such high mRNA levels [20]. Without DNA elements such as STARs, Zeocin gene expression is simply not high enough and no colonies are formed as a result. This creates a very low background, which makes it easy to assess the (positive) influences of exogenous factors on the number of induced colonies.
Of the twelve tested heterologous promoters, we found that one promoter, the human RPL32 promoter, was able to induce a high number of stably transfected colonies in CHO-DG44 cells. The endogenous RPL32 promoter drives the expression of the large ribosomal protein RPL32. The number of induced colonies with the RPL32-β-actin promoter combination was higher than with the addition of STAR elements that also strongly induced an increased number of colonies. We found that also the RPL32-CMV promoter combination resulted in a strong increase of induced colonies. Furthermore, the protein expression levels in these colonies were at least as high as in colonies induced with the aid of STAR elements. We finally show that the positive effects on colony formation and protein expression levels occur under different cell culturing conditions, such as serum free suspension culture medium. The addition of the heterologous RPL32 promoter to a gene expression cassette may be a powerful tool for augmenting gene expression levels.
2. Results2.1. Experimental Setup
We tested whether a second promoter, placed upstream of the “primary” human β-actin promoter might have a positive influence on the number of colonies that are formed in the context of a very stringent selection system. Twelve promoters were chosen for testing: the viral CMV and SV40 promoters, the human β-actin, γ-actin [21, 22], ubiquitin C (UBC) [23], EF1-α [24], glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [25], and five ribosomal protein (RPL32, RPLP1, RPS21, RPL8, and RPL41) promoters [26]. These human genes encode proteins that are, respectively, involved in cytoskeleton formation, protein degradation, protein biosynthesis, carbohydrate metabolism, and the formation of ribosomal subunits. As such they encode the so-called housekeeping proteins, proteins that are required for the maintenance of basal cellular functions [27, 28]. The promoters that we selected belong to genes that convey high mRNA expression levels of their respective genes in human and mouse samples, as determined by Su et al. [29]. The promoters were isolated by PCR (see sequence listing for the primers) with human genomic DNA as template. The identity of the promoters was verified by DNA sequencing.
The promoters were cloned in the STAR-Select vector that conveys a high stringency of selection pressure [19] (Figure 1). In a STAR-Select vector, the Zeocin selection marker is modified to use a start codon that confers attenuated translation initiation frequency, such as TTG, instead of ATG. This modified selection marker is placed upstream of the d2EGFP reporter gene, which, in contrast, has a start codon that confers optimal translation initiation (Figure 1). The stringency of this selection system is so high that the human β-actin promoter is not strong enough to induce substantial colony formation (Figure 1). In fact, only when STAR elements are added to the construct, is the expression of the selection marker enough to induce colony formation (Figure 1) [19]. In these experiments, we therefore included the constructs without any elements as negative control and the construct flanked with the STAR 7/67/7 combination as positive control (Figure 1).
2.2. Placing the Human RPL32 Promoter Upstream of the Human <italic>β</italic>-Actin Promoter Results in the Induction of Many Colonies and High Protein Expression Levels
The same amount of DNA (3 μg) of all constructs was transfected to CHO-DG44 cells with Lipofectamine 2000 (Invitrogen). Selection was performed with 400 μg/ml Zeocin in the culture medium, which was added 24 hours after transfection. After approximately two weeks, the number of stably established colonies was counted. As shown in Figure 2, transfection of the construct encompassing STAR 7/67/7 resulted in 125 stable colonies. The construct with only the human β-actin promoter (negative control) gave < 10 colonies. A similar result (<25 colonies) was obtained with ten heterologous promoter elements placed upstream of the human β-actin promoter, except for the construct with the RPL8 upstream of the human β-actin promoter (50 colonies), and in particular with the RPL32 promoter (>400 colonies) (Figure 1).
Up to 24 independent colonies induced by the indicated constructs were isolated. Colonies were propagated before analysis by flow cytometry (FACS), approximately 6 weeks after transfection. The fluorescence signal derived from d2EGFP (destabilized) is positively correlated with the promoter activity and is thus a reliable indicator of the d2EGFP expression levels in the cell. In a single FACS analysis, fluorescence signals from a sample that contains up to 4000 cells are analyzed. One such sample of cells is taken from an independent, stably transfected cell colony. Since the signal will vary amongst the individual cells in the colony, the mean fluorescence level of the ~4000 cells in the sample is taken as a measure for the d2EGFP expression level (arbitrary units) in the stably transfected cell colony. As shown in Figure 2, placing heterologous promoters upstream of the β-actin promoter resulted in varying d2EGFP expression values. At the lower end of the spectrum, the EF1-α promoter, placed upstream of the β-actin promoter induced very low d2EGFP values (Figure 2), as well as a low number of colonies (Figure 1). In contrast, the human RPLP1 promoter, placed upstream of the β-actin promoter induced a small number of colonies (Figure 1), but the d2EGFP expression levels were high in these colonies (Figure 2). Importantly though, the d2EGFP expression levels in the construct with the RPL32-β-actin promoter combination were equally high as in the STAR 7/67/7-induced d2EGFP values (Figure 2).
We conclude that placing the RPL32 upstream of the β-actin promoter, in combination with the TTG Zeo d2EGFP expression unit induces more colonies than the STAR 7/67/7 combination in CHO-DG44 cells. Furthermore, the d2EGFP expression values in these clones equal the expression levels in the STAR 7/67/7-induced clones. In addition, when compared to the construct without STAR elements, incorporation of the RPL32 promoter in the construct leads to the induction of many more colonies.
2.2.1. Placing the heterologous RPL32 Promoter Upstream of Other Promoters Than the <italic>β</italic>-Actin Promoter Also Results in the Induction of many Colonies and High Protein Expression levels
The above experiments were all performed in the context of the β-actin promoter, and thus the effects of the heterologous RPL32 promoter might be promoter specific. We therefore also tested whether RPL32 had a beneficial effect on promoters other than the human β-actin promoter. We placed the RPL32 promoter upstream of the viral CMV and SV40 and the EF1α promoters (Figure 3). As controls, we flanked the CMV, SV40, and EF1α driven constructs with the STAR 7/67/7 combination, or with no flanking DNA elements at all. As shown in Figure 3, we found that the RPL32 promoter placed upstream of any promoter induced many more colonies as compared to the constructs without flanking DNA elements. When compared to the constructs containing STAR elements, the RPL32-CMV promoter combination induced ~3 times more colonies than the STAR 7/67/7-CMV promoter combination. This is similar to the result with the β-actin promoter (Figure 3). The RPL32 promoter induced, respectively, an equal number or ~1.5 times more colonies when placed upstream of the SV40 or EF1α promoter.
When the d2EGFP expression levels were determined in these respective clones, we found that the RPL32-β-actin and RPL32-EF1α promoter combinations induced equal d2EGFP expression levels as the STAR 7/67/7 combination (Figure 3), as also observed above. However, with the CMV and SV40 promoters, the RPL32 promoter induced substantially higher d2EGFP expression levels than the STAR 7/67/7 combination (Figure 3). Furthermore, transient d2EGFP expression levels were determined 24 hours after transfection of these plasmids. In all cases, RPL32 combined with another promoter showed increased transient d2EGFP expression levels compared to either the STAR 7/67/7 combination or with no flanking elements (data not shown). This indicates that RPL32 induces an increased transcription rate. We therefore conclude that the RPL32 promoter, placed upstream of different promoters, has a beneficial effect on these promoters, in terms of transient transcription levels, induced colony numbers, and protein expression levels and also that the observed effects are not restricted to the β-actin promoter.
2.3. Requirements and Configurations That Influence the Positive Effects of the Heterologous RPL32 Promoter on Colony Formation and Protein Expression Levels
We created constructs in which the RPL32 promoter was placed in different orientations relative to the β-actin promoter, as shown in Figure 4. As control, we used the RPL32 promoter alone, placed immediately upstream of the TTG Zeo-d2EGFP cassette. As controls, we also used the β-actin promoter alone or the β-actin promoter with flanking STAR 7/67/7 elements. All plasmids were transfected to CHO-DG44 cells, colonies were counted as described above, and the d2EGFP expression values in these colonies were determined. We noted that the RPL32 promoter alone induced more colonies than the β-actin promoter alone (Figure 4), in fact more than the range of the number of colonies that was induced by the CMV alone or the SV40 promoter alone (compare with Figure 3). However, either flanking STAR elements or the RPL32 promoter in combination with the β-actin promoter induced far more colonies (Figure 4). Specifically the construct, in which the single RPL32 promoter was placed upstream of the β-actin promoter, induced most colonies (424). Fewer colonies were induced when two RPL32 promoters were used to flank the entire construct on both sides (201). Finally, no colonies at all were induced when the orientation of the RPL32 was reversed, in the sense that the direction of transcription pointed away from the β-actin promoter in the construct (Figure 4). When the d2EGFP values were determined in the respective clones, we observed that the configuration in which a single RPL32 promoter was placed upstream of the β-actin promoter induced the highest average d2EGFP expression levels (Figure 4). Therefore, we favour the configuration in which the RPL32 promoter is placed head to tail with the β-actin promoter.
We next created a series of deletions of the RPL32 promoter to determine the potential crucial regions that convey the positive influence of the RPL32 promoter. As with all tested promoters, we initially isolated a rather large stretch of DNA surrounding the TATA boxes of the promoters. This was done, for instance, because these promoters show a high degree of homology among species in those regions (data not shown). However, the RPL32 promoter lacks a canonical TATA box. The so-called β binding site of the RPL32 promoter contains a DNA sequence element (GGAA) and binds the transcription factor GA-binding protein (GABP), which is an Ets-related protein [30–33]. In spite of the lack of a canonical TATA element in the RPL32 gene promoter, TATA-binding protein (TBP) interacts with a region of 30 base pairs upstream of the cap site without the aid of other factors [34]. This region contains the binding site for the γ factor and indicates that the γ factor may play a role similar to TBP in transcription of the RPL32 gene.
As indicated in Figure 5(a), we deleted several portions, both 5′ and 3′ of the originally isolated 3220 bp (−1918 to +1302 bp with the transcription start at +1) RPL32 promoter region. In addition, we deleted the 76 bp immediately upstream of the transcription start site that contains all the above-described binding sites that are considered important (Figure 5(a)). We called this construct −1918-Δ-1302 (Figure 5(b)). We transfected the respective constructs to CHO-DG44 cells. As shown in Figure 5, we found that the 76 bp upstream of the transcription start site of RPL32 was essential for its influence on the β-actin promoter. No colonies were formed by the construct containing the −1918-Δ-1302 RPL32. Deletion from either the 5′ or 3′ side showed a more complex picture. 5′ deletions up to 691 bp showed no significant changes in colony numbers and the respective d2EGFP values (Figures 5(a) and 5(b)). However, further 5′ deletions, up to 137 bp of the transcription start (Figure 5(a)) resulted in a strongly decreased number of induced colonies and in the respective d2EGFP expression levels (Figure 5(b)). Deletions on the 3′ side were even more complex. The deletion starting at 504 bp downstream of the transcription start (construct −1918 to +504) resulted in increased colony numbers and d2EGFP expression levels equal to the full length RPL32. Instead, deletions starting at 94 bp downstream of the transcription start both resulted in a large decrease of colony numbers and d2EGFP expression values (Figures 5(a) and 5(b)). When either part of the 5′ or the 3′ side was deleted, both colony numbers and d2EGFP expression values decreased.
We conclude that a transcriptionally active RPL32 promoter is essential for its beneficial influence on the β-actin promoter and that the orientation of the RPL32 promoter must be that RPL32 transcription is in the same direction as that of the β-actin promoter (head to tail). Finally, the RPL32 variant in which the most 3′ ~800 bp of the 3220 promoter region that we chose to isolate was deleted shows the most positive effects on the β-actin promoter, in terms of induced colony numbers.
2.4. The Positive Effects of the RPL32 Are Also Apparent in Suspension Cell Cultures
The above-described experiments were all performed in adherent cell cultures. It is, however, possible that promoters and gene-activity-enhancing elements operate differently under serum-free culturing conditions. We therefore transfected control and RPL32-containing constructs under serum-free conditions to CHO-DG44-S suspension cells and cultured them likewise under serum-free suspension conditions. Cells were transfected (nucleofected) in chemically defined medium for DG44 suspension cells, with an Amaxa Nucleofector, and Zeocin selection was started. Three weeks after nucleofection, a stably transfected polyclonal population was poured in semisolid medium, for subcloning. Single colonies were isolated, transferred to 24-well plates and finally to T25 culture flasks. After another 2-3 weeks, protein expression levels were measured.
The CMV promoter drove the expression units, either alone, or flanked by the STAR 7/67/7 combination (Figure 6). In another construct, the RPL32 promoter was placed upstream of the CMV promoter. Finally, a control construct consisted of the RPL32 promoter alone, without CMV promoter or other elements. Unlike adherent cell cultures, be counted independently established stable colonies in suspension cultures cannot. Therefore, as measure for the effectiveness of the different constructs, we determined the percentage of green fluorescent cells within the stably transfected polyclonal population, two weeks after nucleofection. As shown in Figure 6, after two weeks, the CMV promoter alone displayed only 7% green cells, and so did the RPL32 as promoter alone (8%). Only when elements were added to the construct, did the percentage of stably transfected green cells increase significantly, two weeks after nucleofection. This indicated the beneficial effect of the RPL32 promoter on the growth of stably transfected cells. With flanking STAR elements the percentage rose to 15% cells and with the RPL32 promoter, placed upstream of the CMV promoter, to 35%. The d2EGFP values were also determined in isolated subclones, which were cultured in T25 flasks for 2-3 weeks, as the d2EGFP expression values.
We noticed that the average d2EGFP expression values with the different constructs followed the same pattern as the percentage green cells in the polyclonal cell population, after two weeks. That is, the d2EGFP expression values were low with the CMV or RPL32 promoters alone (Figure 6), increased with flanking STAR elements, and were highest with the RPL32 placed upstream of the CMV promoter. These results show that also in suspension growing CHO-DG44-S cells, the RPL32 promoter is an effective tool to increase the number of gene expressing cells as well.
3. Discussion
In this paper, we describe the positive effects on recombinant mammalian cell line formation by placing the RPL32 promoter head-to-tail adjacent to a heterologous promoter. There are many papers describing the negative effects on transcription after placing two promoters adjacent to each other. In most cases, this results in transcriptional interference, which is interpreted as a negative effect [9]. Therefore, the results we showed came as rather unexpected. We conducted these experiments in course of a larger screening effort to identify DNA elements that are able to augment gene activity in the context of a stringent selection system for mammalian cells. Previously, we identified the so-called STAR elements that are able to induce more adherently growing colonies, when employed in a stringent selection system. Still, the number of adherent colonies induced by the presence of STAR elements is limited, and when CHO-DG44-S suspension cells are transfected, there are hardly any stably transfected suspension cell lines established, even when STAR elements are present in the construct. Successful transfection to suspension cells depends in part on the initial percentage of stably transfected cells with sufficient Zeocin-resistance protein expression levels. Elevating this percentage increases the probability to establish stably transfected suspension-growing cell lines. As shown here, incorporation of the extra RPL32 upstream of another promoter indeed allows a more efficient establishment of stably transfected suspension-growing cell lines.
How does this finding relate to previous work? Closest comes the work on UCOEs, which consist of CpG islands with two promoters that are placed in a natural occurring divergent manner. When this DNA element containing two promoters is placed upstream of a third promoter, this results in the creation of many more cell lines [5]. However, we previously showed that this does not result in higher protein expression levels, when employed in the context of the stringent selection system we use here [20]. Another approach has been to combine for instance the β-actin promoter with the CMV enhancer, leading to the creation of a hybrid promoter system. Also this has been reported to have a beneficial effect on protein expression levels [35]. Our results are different from this approach as well, in the sense that we utilize an entire promoter. As shown, the promoter has to be intact, since the deletion of a small region that encompasses the “core” RPL32 promoter region results in the complete loss of positive effects on the human β-actin promoter. This result alone makes it unlikely that RPL32 is an enhancer that is causal for the effects we observe.
The positive effects of addition of the RPL32 promoter we observe are not restricted to just one downstream promoter, but we found the positive effects in combination with the CMV, SV40, EF1-α, and β-actin promoters. Although the effects on these different promoters showed subtle differences, they had the following in common. When compared to a construct that contained no additional DNA elements (such as STAR elements), both the numbers of induced colonies and the protein expression levels in these colonies were highly elevated, but why is it that only the RPL32 promoter, out of twelve tested promoters, has this effect? It is possible that there is a coincidental combination of transcription factor binding sites in the RPL32 promoter and a second, downstream-located promoter that mediates this effect. However, occupation of one promoter by RNA polymerase II could preclude its occupation of the second promoter. For instance, transcription across a promoter from an external promoter transiently precludes its occupation by RNA polymerase II and possibly also associated transcription factors. Furthermore, promoters can compete for the same enhancer. Those are explanations that have been offered for negative promoter interference, and they could possibly also explain why the other eleven promoters we tested donot show positive effects. This is all, however, highly speculative and we do not know why it is that only the tested RPL32 promoter displays these positive effects.
We do know, however, some of the requirements that are needed for the RPL32 to operate in the described manner. For instance, we noticed that in transient transfections there is an increased transcription rate, as signified by the increased transient d2EGFP expression levels. These increases are in comparison with either no DNA elements or the flanking STAR elements in the construct. Also, reversal of the RPL32 promoter orientation in relation to the second promoter completely abolishes the positive effect on colony formation. Finally, deletion of putative regulatory sites in the “core” promoter region completely demolishes the positive effects of the RPL32 promoter. Taken together, we take these observations to support the notion that active transcription from the RPL32 promoter, in the same direction as the downstream promoter is needed to raise the transcriptional activity of downstream-located promoters. This elevated transcription rate is likely to raise the level of Zeocin selection marker protein, with as end result, an increased number of stably transfected colonies.
Deletion of a large portion of the 3′ located intron also brings the putative start site of the RPL32 start site closer to the start site of the human β-actin promoter. This results in an increased number of induced colonies, as compared to the use of the RPL32 that retains the entire intron. However, the putative start site of the RPL32 promoter is already very close to the start sites of the CMV (1890 bp), SV40 (1641 bp) or the EF1-α (1493 bp), promoters, as compared to the 3858 bp of the human β-actin promoter transcription start site. Therefore, the distance between the start sites of the RPL32 and respective downstream promoters seems to be not very critical.
In conclusion, our results indicate that the RPL32 promoter can be a useful tool to increase the number of stably transfected colonies, when employed in the context of a stringent selection system. This may be in particular beneficial for suspension cells transfected and grown in serum-free suspension culture medium, which after all is the vehicle in which proteins are produced on an industrial scale.
4. Experimental Protocol4.1. Vector Constructions
For cloning the various promoters, we used our STAR-Select vector [19] and first replaced the CMV promoter by either the human β-actin promoter, SV40 promoter, or EF1α promoter. STAR elements 7 and 67 (5′) were replaced by the various promoters, and STAR 7 (3′) was removed. The human CMV immediate-early promoter/enhancer originated from pcDNA3 (Invitrogen) and the SV40 promoter from pBabe-Puro [36]. The other promoters were isolated by PCR using human genomic DNA as template. Primer sequences used for these PCRs are as follows (F: forward; R: reverse):
<italic>β</italic>-actin:
5′ GCCCCAGTGACAGCTCCGAAAGCTCCCTTACAGGGCAAAG 3′
5′ GGTGAGCTGCGAGAATAGCCGGGCGCGCTG 3′;
<italic>γ</italic>-actin promoter:
5′ AATTCCAGCAGCGCACAAGGAAACCGTAGTGC 3′
5′ TGCGACCTGCCCGGAAAAGGATGGACTCAG 3′;
UBC promoter:
5′ CCATGCCTCCCTGTTGGCATCAAGTAGGACC 3′
5′ TGTCTAACAAAAAAGCCAAAAACGGCCAGAATTTAGCGGAC 3′;
GAPDH promoter:
5′ CACAATGTCAATAGCGTCACAGTTGAGAAAACCTGC 3′
5′ GGTGTCTGAGCGATGTGGCTCGGC 3′;
RPS21 promoter:
5′ TTTGAGACGCAGTCTTGCTCTGTCGCCCAGGCTGG 3′
5′ TTCGAGGCTGGGCTGCGCCTGGGGAGTCAC 3′;
RPL41 promoter:
5′ GAGGCGGGAGAATCGCTTGTATTCAGGAGG 3′
5′ GGCGCAGAGGTTTCTACAGGGAAAGAGAG 3′;
RPL32 promoter:
5′ CTTGGCATTGACTTAGACACCCTAGGAATCTAACTTGAG 3′
5′ GATGCCTTTTGGGGAAGAAGCGGC 3′;
RPL8 promoter:
5′ TGTGAGCAACAGCGGGCACAGGACACCCTTC 3′
5′ GGCGACGGGTCCTGGGGGCGACTCACGATTAG 3′;
RPLP1 promoter:
5′ GGGGCAGTGGAATTTGTCTGAAGTAACTGTTGAATCCAC 3′
5′ GGCGCGGGCGAGTGTAGGGCTG 3′;
EF1<italic>α</italic> promoter:
5′ GTGCCCGTCAGTGGGCAG 3′
5′ TCACGACACCTGAAATGGAAG 3′;
RPL32 (−1918<italic>–</italic>504):
5′ CTTGGCATTGACTTAGACACCCTAGGAATCTAACTTGAG 3′
5′ CGACCTACAGCTCGTCTTTCCTTGG 3′;
RPL32 (−1918<italic>–</italic>94):
5′ CTTGGCATTGACTTAGACACCCTAGGAATCTAACTTGAG 3′
5′ GCCAGATGAATCCCGCAGGAATGC 3′;
RPL32 (−691<italic>–</italic>1302):
5′ AGTAGCTCGTGCCCGTAATCCCAG 3′
5′ GATGCCTTTTGGGGAAGAAGCGGC 3′;
RPL32 (−137<italic>–</italic>1302):
5′ CTCAGAATTTTTGCGGCATTATTTTTTGACGTGTC 3′
5′ GATGCCTTTTGGGGAAGAAGCGGC 3′;
RPL32 (−691<italic>–</italic>504):
5′ AGTAGCTCGTGCCCGTAATCCCAG 3′
5′ CGACCTACAGCTCGTCTTTCCTTGG; 3′
RPL32 (−1918-∆-1302):
5′ CTTGGCATTGACTTAGACACCCTAGGAATCTAACTTGAG 3′
5′ GCTCCGGCTCTTTTAAATAAAATAAAGACACGTC 3′
5′ CTCTTCCTCGGCGCTGCCTAC 3′
5′ GATGCCTTTTGGGGAAGAAGCGGC 3′.
For RPL32 (−1918-∆-1302), two PCRs were performed to remove the region containing binding sites important for promoter functioning. The two PCR fragments were ligated by using a restriction site introduced by PCR.
A short DNA sequence run was performed on the isolated DNA sequences to verify that we indeed isolated the intended sequences.
4.2. Cell Culture, Transfection, and Analysis of Clones
CHO-DG44 cells [37] were grown in HamF12:DMEM medium (Invitrogen), supplemented with 4.6% fetal bovine serum (FBS) (Invitrogen), 2 mM glutamine (Invitrogen), 100 U/ml penicillin (Invitrogen), 100 μg/ml streptomycin (Invitrogen), 100 μM sodium hypoxanthine (Invitrogen), 16 μM thymidine (Invitrogen), and 10 mM MgCl2 at 37°C/5% CO2.
For transfections, 0.4 · 106 CHO-DG44 cells were seeded in 6-well culture plates 24 hours prior to transfection. Cells were transfected with 3 μg of plasmid DNA using Lipofectamine 2000 (Invitrogen) as described by the manufacturer. In brief, Lipofectamine 2000 was combined with plasmid DNA at 4 μl/μg DNA. The mixture was added to the cells, which had grown to 70–90% confluence. After 5 hours, the transfection mixture was replaced by fresh medium. The following day, cells were seeded in serial dilutions into a medium containing Zeocin (Invitrogen) at a concentration of 400 μg/ml. Approximately 12 days after transfection, individual colonies became visible, and these were isolated and propagated in 24-well plates in medium containing Zeocin. When grown to ~70% confluence, cells were transferred to 6-well plates. Cells were continued to grow in 6-well plates for another one to two weeks before FACS analysis or ELISA was performed. The d2EGFP expression levels were determined on an Epics XL Beckman Coulter flow cytometer. In case of transient transfections, d2EGFP expression levels were determined 24 hours following transfection. Values were visualized using Graphpad Prism 5 for Windows.
Wild-type CHO DG44-S suspension cells (Invitrogen) were grown in serum-free CD-DG44 medium (Invitrogen) supplemented with 8 mM glutamine (Invitrogen), pluronic acid (Invitrogen), and anticlumping agent (Invitrogen) at 37°C/8% CO2 on a shaker (130 rpm). Cells were passaged every 2-3 days. Cells were transfected (nucleofected) with an Amaxa Nucleofector, using the Nucleofection-kit Amaxa V, as described by the manufacturer. In brief, culture medium was supplemented with ITS (Invitrogen), and medium was equilibrated in the incubator to adjust pH. For each nucleofection, 1 · 106 wild-type DG44-S cells, grown to a density between 7 · 105 and 1 · 106/ml and with a viability of >90%, were centrifuged in a swing out centrifuge (900 rpm, 5 minutes). Cell pellets were dissolved in 100 μl nucleofector solution, and 5 μg DNA (in a volume of 5 μl) was added. Samples were transferred to a cuvette and electroporation in the Amaxa Nucleofector was performed (using program U-30), after which the samples were transferred to the equilibrated culture medium (in 6-well culture plates). After 5 hours, the cells were transferred to T25 (suspension) culture flask, in a total volume of 5 ml. After 48 hours, selection was started by adding 50 μg/ml Zeocin to the culture medium. Medium was refreshed every 2-3 days. During the next three weeks, the viability of the cells was monitored and, if applicable, d2EGFP expression levels were determined. Three weeks after nucleofection, 5000–10000 viable cells/ml were poured in semisolid medium (Genetix), to form subclones. After ten days, colonies were isolated and transferred to 96-well culture plates in 100 μl culture medium. After another week, cells could be transferred to 24-well plates (in 0.5 ml medium). Selected subclones were propagated to grow in T25 culture flasks (in 5 ml medium). After another 2-3, weeks d2EGFP expression levels were determined.
Zahn-ZabalMKobrMGirodPADevelopment of stable cell lines for production or regulated expression using matrix attachment regionsJournal of Biotechnology2001871294211267697KimJMKimJSParkDHImproved recombinant gene expression in CHO cells using matrix attachment regionsJournal of Biotechnology200410729510514711493GirodPAZahn-ZabalMMermodNUse of the chicken lysozyme 5′ matrix attachment region to generate high producer CHO cell linesBiotechnology and Bioengineering200591111115889435AntoniouMHarlandLMustoeTTransgenes encompassing dual-promoter CpG islands from the human TBP and HNRPA2B1 loci are resistant to heterochromatin-mediated silencingGenomics200382326927912906852WilliamsSMustoeTMulcahyTCpG-island fragments from the HNRPA2B1/CBX3 genomic locus reduce silencing and enhance transgene expression from the hCMV promoter/enhancer in mammalian cellsBMC Biotechnology20055, article no. 17GerasimovaTICorcesVGChromatin insulators and boundaries: effects on transcription and nuclear organizationAnnual Review of Genetics200135193208MutskovVJFarrellCMWadePAWolffeAPFelsenfeldGThe barrier function of an insulator couples high histone acetylation levels with specific protection of promoter DNA from methylationGenes and Development200216121540155412080092KwaksTHJBarnettPHemrikaWIdentification of anti-repressor elements that confer high and stable protein production in mammalian cellsNature Biotechnology2003215553558ShearwinKECallenBPEganJBTranscriptional interference—a crash courseTrends in Genetics200521633934515922833GregerIHDemarchiFGiaccaMProudfootNJTranscriptional interference perturbs the binding of Sp1 to the HIV-1 promoterNucleic Acids Research1998265129413009469840WangPYangJIshihamaAPittardAJDemonstration that the TyrR protein and RNA polymerase complex formed at the divergent P3 promoter inhibits binding of RNA polymerase to the major promoter, P1, of the aroP gene of Escherichia coliJournal of Bacteriology199818020546654729765583EszterhasSKBouhassiraEEMartinDIKFieringSTranscriptional interference by independently regulated genes occurs in any relative arrangement of the genes and is influenced by chromosomal integration positionMolecular and Cellular Biology200222246947911756543CallenBPShearwinKEEganJBTranscriptional interference between convergent promoters caused by elongation over the promoterMolecular Cell200414564765615175159Buetti-DinhAUngrichtRKelemenJZShettyCRatnaPBecskeiAControl and signal processing by transcriptional interferenceMolecular Systems Biology20095, article no. 300LeupinOAttanasioCMargueratSTapernouxMAntonarakisSEConradBTranscriptional activation by bidirectional RNA polymerase II elongation over a silent promoterEMBO Reports200561095696016113646HanYLinYBAnWOrientation-dependent regulation of integrated HIV-1 expression by host gene transcriptional readthroughCell Host and Microbe20084213414618692773KozakMContext effects and inefficient initiation at non-AUG codons in eucaryotic cell-free translation systemsMolecular and Cellular Biology1989911507350802601709KozakMDownstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomesProceedings of the National Academy of Sciences of the United States of America19908721830183052236042van BloklandHJMKwaksTHJSewaltRGABA novel, high stringency selection system allows screening of few clones for high protein expressionJournal of Biotechnology2007128223724517092592OtteAPKwaksTHJVan BloklandRJMVarious expression-augmenting DNA elements benefit from STAR-select, a novel high stringency selection system for protein expressionBiotechnology Progress200723480180717585780PontePNgSYEngelJGunningPKedesLEvolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNANucleic Acids Research1984123168716966322116ErbaHPGunningPKedesLNucleotide sequence of the human γ cytoskeletal actin mRNA: anomalous evolution of vertebrate non-muscle actin genesNucleic Acids Research19861413527552943737401WiborgOPedersenMSWindABerglundLEMarckerKAVuustJThe human ubiquitin multigene family: some genes contain multiple directly repeated ubiquitin coding sequencesEMBO Journal1985437557592988935UetsukiTNaitoANagataSKaziroYIsolation and characterization of the human chromosomal gene for polypeptide chain elongation factor-1αJournal of Biological Chemistry198926410579157982564392ErcolaniLFlorenceBDenaroMAlexanderMIsolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase geneJournal of Biological Chemistry19882633015335153413170585PerryRPThe architecture of mammalian ribosomal protein promotersBMC Evolutionary Biology20055WarringtonJANairAMahadevappaMTsyganskayaMComparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genesPhysiological Genomics20002000214314711015593EisenbergELevanonEYHuman housekeeping genes are compactTrends in Genetics200319736236512850439SuAICookeMPChingKALarge-scale analysis of the human and mouse transcriptomesProceedings of the National Academy of Sciences of the United States of America20029974465447011904358ThompsonCCBrownTAMcKnightSLConvergence of Ets- and Notch-related structural motifs in a heteromeric DNA binding complexScience199125350217627681876833MacleodKLeprinceDStehelinDThe ets gene familyTrends in Biochemical Sciences19921772512561502727YoganathanTBhatNKSellsBHA positive regulator of the ribosomal protein gene, β factor, belongs to the ETS oncoprotein familyBiochemical Journal199228723493531445193GenuarioRRKelleyDEPerryRPComparative utilization of transcription factor GABP by the promoters of ribosomal protein genes rpL30 and rpL32Gene Expression1993332792888019128YoganathanTHorikoshiMHasegawaSRoederRGSellsBHYeast transcription factor IID participates in cell-free transcription of a mammalian ribosomal protein TATA-less promoterBiochemical Journal199228537217231497610ChungSAnderssonTSonntagKCBjörklundLIsacsonOKimKSAnalysis of different promoter systems for efficient transgene expression in mouse embryonic stem cell linesStem Cells200220213914511897870MorgensternJPLandHAdvanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell lineNucleic Acids Research19901812358735962194165UrlaubGKasECarothersAMChasinLADeletion of the diploid dihydrofolate reductase locus from cultured mammalian cellsCell19833324054126305508
Heterologous promoters that are screened for their ability to elevate the formation of stable CHO-DG44 colonies in the context of a stringent selection system. Twelve human promoters were placed upstream of the human β-actin promoter. As selection system, a modified Zeocin selection marker, TTG Zeocin was placed upstream of the d2EGFP reporter gene. As control constructs, either no DNA elements are incorporated to the construct, or STAR elements are added to flank the expression cassette. Equal amounts of DNA were transfected to CHO-DG44 and after ~two weeks colonies were counted.
d2EGFP fluorescence values in colonies induced by heterologous promoter combinations. The d2EGFP expression values were determined in stable colonies comprising DNA constructs described in Figure 1. The relative fluorescence levels were taken as arbitrary units. The average d2EGFP expression levels for each construct are indicated with a short line. The average d2EGFP expression of 637 induced by STARs 7/67/7 in the context of the TTG Zeo selection system is indicated with the horizontal line.
Addition of the RPL32 promoter has beneficial effects in the context of multiple heterologous promoters. The RPL32 promoter was placed upstream of the β-actin, CMV, SV40, and EF-1α promoter, which drove the TTG Zeo- d2EGFP expression cassette. Control constructs with the four different promoters contained either no extra DNA element, or flanking STAR 7/67/7 elements. Equal amounts of DNA were transfected to CHO-DG44, and after approximately two weeks, colonies were counted. Up to 24 stable colonies were isolated, and d2EGFP expression values were determined. The respective colony numbers are shown above the d2EGFP expression values.
Optimal orientations of the RPL32 promoter in relation to the β-actin promoter. The RPL32 promoter was placed in configurations as shown at the top of the figure. Control constructs contained only the RPL32 promoter, the β-actin promoter without any DNA element, or with flanking STAR 7/67/7 elements. Equal amounts of DNA were transfected to CHO-DG44 and after approximately two weeks colonies were counted. Up to 24 stable colonies were isolated, and d2EGFP expression values were determined. The respective colony numbers are shown above the d2EGFP expression values.
Deletion analysis of the RPL32 promoter reveals critical regions. Several deletion mutants of the RPL32 promoter were created as shown at the top of the figure. The constructs were transfected to CHO-DG44 cells, up to 24 stable colonies were isolated, and d2EGFP expression values were determined. The respective colony numbers are shown above the d2EGFP expression values.
The beneficial effects of the RPL32 promoter on heterologous promoters are also observed in serum-free suspension cell lines. A construct in which the RPL32 promoter was placed upstream of the CMV promoter was compared to constructs with the CMV promoter, but without any DNA elements, or to a construct with STAR elements, as well a construct in which the RPL32 promoter alone drove the expression cassette. The constructs were transfected to serum-free suspension CHO-DG44-S cells. After two weeks, the percentage of green cells was determined, as shown in the numbers above d2EGFP values. Then subclones were isolated and propagated, and d2EGFP values were determined.
oai:pubmedcentral.nih.gov:30394132011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30394132135066010.4061/2011/454090Research ArticleBiosynthesis of Silver Nanoparticles from Desmodium triflorum: A Novel Approach Towards Weed UtilizationAhmadNaheed1SharmaSeema2*SinghV. N.3ShamsiS. F.4FatmaAnjum5MehtaB. R.31Department of Botany, Patna University, Patna 800013, India2Department of Physics, A.N.College, Patna 800013, India3Thin Film Laboratory, Department of Physics, Indian Institute of Technology, New Delhi 110016, India4Department of Electrical and Electronic Engineering, SMIT, Sikkim, India5Department of Chemistry, Magadh Mahila College, Patna University, Patna 800013, India*Seema Sharma: seema_sharma26@yahoo.com
A single-step environmental friendly approach is employed to synthesize silver nanoparticles. The biomolecules found in plants induce the reduction of Ag+ ions from silver nitrate to silver nanoparticles (AgNPs). UV-visible spectrum of the aqueous medium containing silver ions demonstrated a peak at 425 nm corresponding to the plasmon absorbance of silver nanoparticles. Transmission electron microscopy (TEM) showed the formation of well-dispersed silver nanoparticles in the range of 5–20 nm. X-ray diffraction (XRD) spectrum of the AgNPs exhibited 2θ values corresponding to the silver nanocrystal. The process of reduction is extracellular and fast which may lead to the development of easy biosynthesis of silver nanoparticles. Plants during glycolysis produce a large amount of H+ ions along with NAD which acts as a strong redoxing agent; this seems to be responsible for the formation of AgNPs. Water-soluble antioxidative agents like ascorbic acids further seem to be responsible for the reduction of AgNPs. These AgNPs produced show good antimicrobial activity against common pathogens.
1. Introduction
Nanoparticles with controlled size and composition are of fundamental and technological interest as they provide solutions to technological and environmental challenges in the areas of solar energy conversion, catalysis, medicine, and water treatment. Thus, production and application of nanomaterials from 1 to 100 nanometers (nm) is an emerging field of research [1, 2]. Global warming and climate change have induced a worldwide awareness and effort to reduce generated hazardous wastes. Thus, “Green” chemistry and chemical processes are progressively being integrated in science and industry for sustainable development [3].
Nanomaterials due to their sheer size show unique and considerably changed physical, chemical, and biological properties compared to their macro scale counterparts [4]. Gold, silver, and copper have been used mostly for the synthesis of stable dispersions of nanoparticles, which are useful in areas of photography, catalysis, biological labeling, photonics, optoelectronics, and surface-enhanced Raman scattering (SERS) detection [5–7].
Biological methods are considered safe and ecologically sound for the nanomaterial fabrication as an alternative to conventional physical and chemical methods. Biological routes to the synthesis of these particles have been proposed by exploiting microorganisms [8–12] and by vascular plants [13–22]. The functions of these materials depend on their composition and structure. Plants have been reported to be used for synthesis of metal nanoparticles of gold and silver and of a gold-silver-copper alloy [13–22]. Colloidal silver is of particular interest because of its distinctive properties such as good conductivity, chemical stability, and catalytic and antibacterial activity [23–25].
India has great potential for bioprospecting because of its rich biodiversity. Advances in biotechnology have increased the value of plant genetic resources. Leguminous plants possess important natural products and phytochemicals that are useful as industrial, medicinal, and agricultural raw materials. However, most of these legume species have not been fully exploited for their chemical or biologically active components. One of the largest tropical wild species of legume is Desmodium, with Southeast Asia as an important centre of species diversification. The genus Desmodium Desv. nom. cons (Fabaceae) has a worldwide distribution and consists of over 300 species with 67 species native to India [26]. The genus has proved to be important in possessing various phytochemicals. The chemical literature [26, 27] reveals that the species Desmodium triflorum are rich in polyphenols, flavonoids, sterols, triterpenes, and reducing sugars in all extracts. The plants are also used extensively in traditional medicine.
Studies have indicated that biomolecules like protein, phenols, and flavonoids not only play a role in reducing the ions to the nanosize, but also play an important role in the capping of the nanoparticles [28–30]. The reduction of Ag+ ions by combinations of biomolecules found in these extracts such as vitamins, enzymes/proteins, organic acids such as citrates, amino acids, and polysaccharides [29–31] is environmentally benign, yet chemically complex.
We have looked at the composition of other plants for possible presence of such molecules and have identified Desmodium plants as a potential candidate for synthesis of silver nanoparticles [31]. Extracts from this plant may act both as reducing and capping agents in AgNPs synthesis. This paper demonstrates that the reaction of aqueous silver ions with Desmodium triflorum extract resulted in the extracellular formation of AgNPs at room temperature which was further harvested by simple heat drying evaporation. As most of the bacteria have developed resistance to antibiotics there is a need for an alternative antibacterial substance [32]. Silver is known for its antimicrobial properties and has been used for years in the medical field for antimicrobial applications and even has shown to prevent HIV binding to host cells [33–35]. The AgNPs are also reported to be nontoxic to human and most effective against bacteria, viruses, and other eukaryotic micro-organisms at very low concentration and without any side effects [36]. We have also made an attempt to find out the use of these bioprospected plant-mediated synthesized AgNPs as possible antimicrobial agents. Silver nanoparticles may have an important advantage over conventional antibiotics in that they kill all pathogenic microorganisms, and no organism has ever been reported to readily develop resistance to it.
2. Results and Discussion2.1. Addition of the Plant Broth to the 10<sup>3</sup> M Aqueous AgNO<sub>3</sub> Resulted in Change of Colour within Minutes (inset <xref ref-type="fig" rid="fig1">Figure 1</xref>)
The signatory tea-brown color was obtained which resulted due to the excitation of the Surface Plasmon Resonance (SPR) vibrations of the silver nanoparticles formed. The reaction could easily be tracked by the change in color and reconfirmed by UV-Vis spectroscopy.
Figure 1 shows UV-Vis spectra of the aqueous plant extracts with AgNO3 (0.025 M) solution. The weak absorption peak at 200 nm (not shown here) indicates the presence of several organic compounds which are known to interact with silver ions. An absorption band at 270 nm is attributed to the aromatic amino acids of proteins. It is well known that the absorption band at 270 nm arises due to electronic excitations in tryptophan and tyrosine residues in the proteins. This observation indicates the release of proteins into solution by Desmodium triflorum and suggests a possible mechanism for the reduction of the metal ions present in the solution. Disturbances in the 200–320 nm were observed after 1 hour of the reaction probably indicating that the capping occurs after the reduction of the silver nanoparticles. The samples display an optical absorption band peaked at about 420 nm, typical of absorption for metallic Ag nanoclusters, due to the Surface Plasmon Resonance (SPR), which increased with time till about three hours of reaction period. Plasmon bands are broad with an absorption tail in the longer wavelengths. The cause of the infrared absorption is the stretching vibration within the molecule and could be due to the presence of N2, H2, C, and O2 bonds. In principle it could be due to the excitation of the in-plane SPR and probably indicate significant anisotropy in the shape of nanoparticles.
2.2. Plants Contain a Complex Network of Antioxidant Metabolites and Enzymes That Work together to Prevent Oxidative Damage to Cellular Components
Isolated quercetin [37] and polysaccharides [28–31] have been used for the synthesis of silver nanoparticles. Desmodium is reported to contain chemically different groups of compounds: polyphenols, flavonoids, sterols, triterpenes, triterpenoid saponins, beta-phenylethylamines, tetrahydroisoquinolines, reducing sugars like glucose and fructose, and proteins, in all extracts. The plant extract is reported to have activities of scavenging superoxide anion radicals and 1, 1-diphenyl-2-picrylhydrazyl radicals (DPPH). It could be that these water-soluble scavenging superoxide anion radicals and 1, 1-diphenyl-2-picrylhydrazyl (DPPH) radicals present in the plant extract be responsible for the reduction of silver and synthesis of nanoparticles through biogenic routes. The exact mechanism of the formation of these nanoparticles in these biological media is unknown. Presumably, biosynthetic products or reduced cofactors play an important role in the reduction of respective salts to nanoparticles. However, it seems probable that some glucose and ascorbate reduce AgNO3 to form nanoparticles.
The probability of reduction of AgNO3 to silver may be illustrated due to the mechanism known as glycolysis. Plants fix CO2 in presence of sunlight. Carbohydrates are the first cellular constituent formed by the photosynthesizing organism on absorption of light. This carbohydrate is utilized by the cell as glucose by Glycolysis. This is the metabolic pathway that converts glucose C6H12O6 into pyruvate and hydrogen ion:
CH3COCOO−+H+.
The free energy released in this process is used to form the high-energy compounds, ATP adenosine triphosphate and NADH (reduced nicotinamide adenine dinuleotide). Glycolysis can be represented by the following simple equation:
Glucose+2ADP+2Pi+2NAD+=2Pyruvate+2ATP+2NADH+2H+.
Glycolysis is a definite sequence of ten reactions involving ten intermediate compounds (Figure 2). Large amount of H+ ions are produced along with ATP.
Nicotinamide adenine dinucleotide, abbreviated NAD+, is a coenzyme found in all living cells. NAD is a strong reducing agent. NAD+ is involved in redox reactions, carrying electrons from one reaction to another. The coenzyme is therefore found in two forms in cells. NAD+ is an oxidising agent—it accepts electrons from other molecules and becomes reduced. This reaction forms NADH, which can donate electrons. These electron transfer reactions are the main function of NAD:
AgNO3→Ag++NO3,NAD++e→NAD,NAD+H+→NADH+e−,e−+Ag+→Ag0
NAD+ keeps on getting reoxidised and gets constantly regenerated due to redox reactions. This might have led to transformations of Ag ions to Ag0.
Another mechanism for the reduction of Ag ions to silver could be due to the presence of water-soluble antioxidative substances like ascorbate. This acid is present at high levels in all parts of plants. Ascorbic acid is a reducing agent and can reduce, and thereby neutralize, reactive oxygen species leading to the formation of ascorbate radical and an electron. This free electron reduces the Ag+ ion to Ag0 (Scheme 1).
2.3. It Is Important to Know the Exact Nature of the Silver Particles Formed, and This Can Be Deduced from the XRD Spectrum of the Sample
XRD pattern of derived AgNPs (Figure 3) shows four intense peaks in the whole spectrum of 2Θ° values ranging from 20° to 70°. XRD spectra of pure crystalline silver structures have been published by the Joint Committee on Powder Diffraction Standards (file no. 04-0783). A comparison of our XRD spectrum with the Standard confirmed that the silver particles formed in our experiments were in the form of nanocrystals, as evidenced by the peaks at 2Θ values of 38.45°, 44.48°, 64.69°, and 77.62°, corresponding to [111], [200], [220], and [311] planes for silver, respectively. Moreover, two small insignificant impurity peaks are observed at 68° and 75° which may be attributed to the presence of other organic substances in culture supernatant.
Scherrer's equation for broadening resulting from a small crystalline size, the mean, effective, or apparent dimension of the crystall composing the powder is
Phkl=kλ/β1/2cosΘ,
where Θ is the Bragg angle, λis the wavelength of the X-ray used, βis the breadth of the pure diffraction profile in radians on 2Θ scale, and k is a constant approximately equal to unity and related both to the crystalline shape and to the way in which Θ is defined. The best possible value of k has been estimated as 0.89. The Full Width at Half Maximum (FWHM) values measured for [111], [200], [220], and [311] planes of reflection were used with the Debye-Scherrer equation (4) to calculate the size of the nanoparticles.
Further analysis of the silver particles by Energy-dispersive spectroscopy confirmed the presence of the signal characteristic of silver. Figure 4 shows the Energy-Dispersive Absorption Spectroscopy photographs of derived AgNPs.
All the peaks of Ag are observed and are assigned. Peaks for Cu and C are from the grid used, and the peaks for S, P, and N correspond to the protein capping over the AgNPs. HRTEM images of Ag nanopatrticles derived from the plant extract are shown in Figure 5. The morphology of the NPs was predominantly spherical, and they appear to be monodisperse. Some of the NPs were found to be oval and/or elliptical. Such variation in shape and size of nanoparticles synthesized by biological systems is common. It was noticeable that the edges of the particles were lighter than the centers, suggesting that biomolecules, such as proteins in Desmodium, capped the silver NPs. It is seen that proteins are present among the particles and are adhered to their surfaces. These figures show NPs having a particle size in the range of 5–20nm. The silver particles are crystalline, as can be seen from the selected area diffraction pattern recorded from one of the nanoparticles in the aggregates (Figure 6).
FTIR measurements were carried out to identify the possible biomolecules responsible for the reduction of the Ag+ ions and the capping of the bioreduced silver nanoparticles synthesized by the broth. The broth after complete reduction of Ag+ was centrifuged at 12000 rpm for 20 minutes to isolate the silver nanoparticles free from proteins or other compounds present in the solution. The representative spectra of nanoparticles obtained (Figure 7) manifest absorption peaks located at about 1030 and 1650, in the region 1000–1750 cm−1.
The absorption peak at around 1030 cm−1 can be assigned as absorption peaks of -C-O-C- or—C-O-. The peak at around 1650 cm−1 is assigned to the amide I bonds of proteins. The bonds or functional groups such as -C-O-C-,—C-O- and -C=C- derived from heterocyclic compounds and the amide I bond derived from the proteins which are present in the extract are the capping ligands of the nanoparticles.
3. Though the Bactericidal Effect of AgNPs is Now Well Established However the Mechanism is Only Partially Understood
It has been reported that ionic silver strongly interacts with thiol group of vital enzymes and inactivates them [34–36]. Experimental evidence suggests that DNA loses its replication ability once the bacteria have been treated with silver ions [38]. The antibacterial effect of nanoparticles can be attributed to their stability in the medium as a colloid, which modulates the phosphotyrosine profile of the bacterial proteins and arrests bacterial growth.
Well diffusion assays were carried out to check the bactericidal activity of the silver nanoparticles they confirmed the antimicrobial activity of the AgNPs. The diffusion disk tests showed, in all the cases, a similar exclusion area that appears only around the nano Ag-discs. Most of the cultures were found to be inhibited in 14–25 μg of silver/mL. However, the multidrug resistant strains of staphylococcus and E.coli had highest MIC value of 57 μg of silver/mL. No significant bacterial growth was observed at AgNPs concentrations above 75 μg/mL.
After 24 hours, the presence of silver nanoparticles at a concentration of 14–60 μg/cm3 inhibited the bacterial growth by 62% and 88%, respectively, while a concentration of 100 μg/cm3 caused 100% inhibition of bacterial growth. It was also observed that a combination of silver nanoparticles with antibiotics showed an approximate 2-fold increase in the MIC values.
The difference in the MIC zones of the different bacteria could be explained due to the presence of peptidoglycan, which is a complex structure and often contains teichoic acids or lipoteichoic acids which have a strong negative charge. This charge may contribute to the sequestration of free Ag+ ions. Thus, gram-positive bacteria may allow less Ag+ to reach the cytoplasmic membrane than the gram-negative bacteria. The studies revealed that there was synergistic effect when the antibiotic was combined with the silver nanoparticles in inhibiting the growth of organisms.
4. Conclusion
Stable and spherically shaped nanoparticles of average size ~10 nm were synthesized using Desmodium plant. The green synthesis of AgNPs fulfills all the three main steps, which must be evaluated based on green chemistry perspectives, including (1) selection of solvent medium, (2) selection of environmentally benign reducing agent, and (3) selection of nontoxic substances for the AgNPs stability. The results showed that Ag nanoparticles presented good antibacterial performance against common pathogens. The nanoparticles when combined with the antibiotics show synergic effect in suppressing growth of antibiotics.
5. Methods and Techniques
Desmodium triflorum is a wild much branched slender diffused herb with trifoliate leaves occurring as small under herb found in grasslands, fields, and agricultural lands forming a green turf on the ground. It was uprooted, washed, and air dried. The entire plant was finely cut and pounded; 50 gms was weighed to which 100 mL of distilled water was added. It was then heated at 60°C for 10 minutes. 5 mL of the source extract was added to 20 mL of 0.025 (M) AgNO3 solutions. The bioreduction of Ag+ ions was monitored by periodic sampling. The pH of the sample was recorded and was found to be close to the pH of the plant broth (~7.88) thus indicating that there was not an appreciable change in the pH value of the cell extract and the plant broth.
The optical absorbance was recorded on UV-Vis spectrophotometer (Systronics 2202 double beam model) in 200–800 nm wavelength range. The solution containing the signatory color of AgNPs (dark brown) was then poured out into petri dishes and left in the oven for drying at 50°C for 24 hours. The formation and quality of compounds were checked by XRD technique. The X-ray diffraction (XRD) pattern measurements of drop-coated film of AgNPs on glass substrate were recorded in a wide range of Bragg angles Θ at a scanning rate of 2°/min, and was carried out on a Philips PW 1830 instrument that was operated at a voltage of 40 kV and a current of 30 mA with Cu Kα radiation (1.5405 Å). High Resolution Transmission Electron Microscopy (HRTEM) was performed by TECHNAIG20-STWIN (200 KV) machine with a line resolution 2.32 (in angstrom). These images were taken by drop coating AgNPs on a carbon-coated copper grid. Energy Dispersive Absorption Spectroscopy photograph of AgNPs was carried out by the HR TEM equipment as mentioned above.
The purified powders of silver nanoparticles were subjected to FTIR spectroscopy measurement. These measurements were carried out on a Siemen sstr 25 78564 instrument in the diffuse reflectance mode at a resolution of 4 cm−1 in KBr pellets. For comparison, a drop of 20% broth was mixed with KBr powder and pelletized after drying properly. The pellets were later subjected to FTIR spectroscopy measurement.
The antibacterial activity of the silver nanoparticles was evaluated by means of minimum inhibitory concentration value and antibacterial rate assays. The plates were incubated at 37°C for 24 hours. Each of the samples was done in six parallel experiments, and the average number of colonies was counted. The antibacterial rates were obtained from the calculation via the following equation:
Antibacterialrate(%)=N0−N1N0×100%,
where N0 and N1 refer to the numbers of bacterium colonies in the control culture plates and the experiment culture plates, respectively.
Minimum Inhibitory concentration (MIC) of AgNPs was determined by the Muellar Hinton (MH) broth by twofold serial dilution method. The concentration of the silver nanoparticles added to the first tube was 850 μ/g silver/media tubes. The media tubes were inoculated with test cultures of three kinds of bacteria, that is, Escherichia coli (gram-negative bacteria), Staphylococcus epidermidis (gram-positive bacteria), and Bacillus subtilis (spore bacteria) (106 CFU/mL) and incubated at 37°C. Presence of the growth was visibly monitored after 48 hours of incubation.
Tubes in which no visual growth was observed were selected. 5 μL of the content was inoculated on the MH agar plates. The absence of growth on the plates confirmed antibacterial activity. The MIC values of gentamicin and active iodine were determined in similar manner for comparison (Table 1).
Acknowledgment
The authors wish to acknowledge UGC for the financial support towards the Major Research Project.
DahlJAMadduxBLSHutchisonJEToward greener nanosynthesisChemical Reviews200710762228226917564480HutchisonJEGreener nanoscience: a proactive approach to advancing applications and reducing implications of nanotechnologyACS Nano20082339540219206562AnstasPTWarnerJGreen Chemistry: Theory and Practice1998New York, NY, USAOxford University PressLiL-SHuJAlivistosAPBand gap variation of size- and shape-controlled colloidal CdSe quantum rodsNano Letters200117349351HussainIBrustMPapworthAJCooperAIPreparation of acrylate-stabilized gold and silver hydrosols and gold-polymer composite filmsLangmuir2003191148314835SmithAMDuanHRhynerMNRuanGNieSA systematic examination of surface coatings on the optical and chemical properties of semiconductor quantum dotsPhysical Chemistry Chemical Physics20068333895390319817050KearnsGJFosterEWHutchisonJESubstrates for direct imaging of chemically functionalized SiO2 surfaces by transmission electron microscopyAnalytical Chemistry200678129830316383340JhaAKPrasadKKulkarniARSynthesis of TiO2 nanoparticles using microorganismsColloids and Surfaces B2009712226229MukherjeePAhmadAMandalDFungus-mediated synthesis of silver nanoparticles and their immobilization in the mycelial matrix: a novel biological approach to nanoparticle synthesisNano Letters2001110515519SpringSSchleiferK-HDiversity of magnetotactic bacteriaSystematic and Applied Microbiology1995182147153DicksonDPENanostructured magnetism in living systemsJournal of Magnetism and Magnetic Materials19992031–34649PumDSleytrUBThe application of bacterial S-layers in molecular nanotechnologyTrends in Biotechnology1999171812JoergerRKlausTGranqvistCGBiologically produced silver-carbon composite materials for optically functional thin-film coatingsAdvanced Materials2000126407409NairBPradeepTCoalescence of nanoclusters and formation of submicron crystallites assisted by Lactobacillus strainsCrystal Growth and Design200224293298AhmadASenapatiSKhanMIKumarRSastryMExtracellular biosynthesis of monodisperse gold nanoparticles by a novel extremophilic actinomycete, thermomonospora spLangmuir200319835503553AndersonCWNBrooksRRStewartRBSimcockRHarvesting a crop of gold in plantsNature19983956702553554Gardea-TorresdeyJLGomezEPeralta-VideaJRParsonsJGTroianiHJose-YacamanMAlfalfa sprouts: a natural source for the synthesis of silver nanoparticlesLangmuir200319413571361Romero-GonzálezJWaltonJCPeralta-VideaJRRodríguezERomeroJGardea-TorresdeyJLModeling the adsorption of Cr(III) from aqueous solution onto Agave lechuguilla biomass: study of the advective and dispersive transportJournal of Hazardous Materials2009161136036518462882ArmendarizVParsonsJGLopezMLPeralta-VideaJRJose-YacamanMGardea-TorresdeyJLThe extraction of gold nanoparticles from oat and wheat biomasses using sodium citrate and cetyltrimethylammonium bromide, studied by x-ray absorption spectroscopy, high-resolution transmission electron microscopy, and UV-visible spectroscopyNanotechnology20092010Article ID 105607.ChandranSPChaudharyMPasrichaRAhmadASastryMSynthesis of gold nanotriangles and silver nanoparticles using Aloe vera plant extractBiotechnology Progress200622257758316599579ShankarSSAhmadASastryMGeranium leaf assisted biosynthesis of silver nanoparticlesBiotechnology Progress20031961627163114656132SathishkumarMSnehaKWonSWChoC-WKimSYunY-SCinnamon zeylanicum bark extract and powder mediated green synthesis of nano-crystalline silver particles and its bactericidal activityColloids and Surfaces B2009732332338TessierPMVelevODKalamburATRaboltJFLenhoffAMKalerEWAssembly of gold nanostructured films templated by colloidal crystals and use in surface-enhanced Raman spectroscopyJournal of the American Chemical Society20001223995549555CaoYCJinRMirkinCANanoparticles with Raman spectroscopic fingerprints for DNA and RNA detectionScience200229755861536154012202825RosiNLMirkinCANanostructures in biodiagnosticsChemical Reviews200510541547156215826019BelloniJPhotography: enhancing sensitivity by silver-halide crystal dopingRadiation Physics and Chemistry2003673-4291296SanjappaMSinghBSinghMPBotanical Survey of India1992VedpriyaALiving Systems: eco-friendly nanofactoriesDigest Journal of Nanomaterials and Biostructures201051921Collera-ZúñigaOGarcía JiménezFMeléndez GordilloRComparative study of carotenoid composition in three mexican varieties of Capsicum annuum LFood Chemistry2005901-2109114JagadeeshBHPrabhaTNSrinivasanKImproved shelf life of bell capsicum fruits by manipulation of the activities of glycosidases through heatIndian Journal of Plant Physiology200492164168AhmadNAlamMKSinghVNSharmaSBioprospecting AgNPs from wild desmodium speciesJournal of Bionanoscience20093297104SharmaVKYngardRALinYSilver nanoparticles: green synthesis and their antimicrobial activitiesAdvances in Colloid and Interface Science20091451-2839618945421ElechiguerraJLBurtJLMoronesJRInteraction of silver nanoparticles with HIV-1Journal of Nanobiotechnology20053, article no. 6RussellADHugoWBAntimicrobial activity and action of silverProgress in Medicinal Chemistry1994313513708029478LeeHYParkHKLeeYMKimKParkSBSilver nanoparticles and its antibacterial evaluation for biomedical applicationsChemical Communications200728p. 2885JeongSHYeoSYYiSCThe effect of filler particle size on the antibacterial properties of compounded polymer/silver fibersJournal of Materials Science2005402054075411WuT-HYenF-LLinL-TTsaiT-RLinC-CChamT-MPreparation, physicochemical characterization, and antioxidant effects of quercetin nanoparticlesInternational Journal of Pharmaceutics20083461-216016817689897PalSTakYKSongJMDoes the antibacterial activity of silver nanoparticles depend on the shape of the nanoparticle? A study of the gram-negative bacterium Escherichia coliApplied and Environmental Microbiology20077361712172017261510
UV/Vis spectra recorded from the culture supernatant that shows the production of AgNPs after 24 hours of reaction. Inset photograph shows change in colour after adding AgNO3, (a) after 5 minutes, (b) after 20 minutes and (c) 1 hour.
Schematic representation of glycolysis and its reaction with AgNO3 for production of AgNPs.
Room temperature X-ray diffractogram of silver nanoparticles.
Energy-Dispersive Absorption Spectroscopy photograph of AgNPs.
Transmission electron microscopy images of AgNPs at different magnifications.
Selected area electron diffraction showing the characteristic crystal planes of elemental silver.
FTIR spectra of capped silver nanoparticles synthesized using Desmodium broth.
Comparison of MIC values of AgNPs.
Microorganisms
AgNPs (μg/mL)
Gentamiycin (μg/mL)
Active iodine (μg/mL)
Staphylococcus spp (gram-positive bacteria)
53
1255
1562
Escherichia coli (gram-negative bacteria)
27
1.2
1.5
Bacillus subtilis
54
<1.0
<1.2
oai:pubmedcentral.nih.gov:30394312011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30394312135065910.4061/2011/274693Review ArticleBiosynthesis and Virulent Behavior of Lipids Produced by Mycobacterium tuberculosis: LAM and Cord Factor: An OverviewRajniRaoNishaMeenaLaxman S.*Institute of Genomics and Integrative Biology (CSIR), Delhi University Campus, Mall Road, Delhi 110007, India*Laxman S. Meena: meena@igib.res.in
Mycobacterium tuberculosis is the causative agent of tuberculosis disease, which has developed a myriad of exceptional features contributing to its survival within the hostile environment of host cell. Unique cell wall structure with high lipid content plays an imperative role in the pathogenicity of mycobacteria. Cell wall components of MTB such as lipoarabinomannan and Trehalose dimycolate (cord factor) are virulent in nature apart from its virulence genes. Virulent effect of these factors on host cells reduces host cell immunity. LAM has been known to inhibit phagosome maturation by inhibiting the Ca2+/calmodulin phosphatidyl inositol-3-kinase hvps34 pathways. Moreover, TDM (Trehalose dimycolate) also inhibits fusion between phospholipid vesicles and migration of polymorphonuclear neutrophils. The objective of this paper is to understand the virulence of LAM and cord factor on host cell which might be helpful to design an effective drug against tuberculosis.
1. Introduction
Mycobacterium tuberculosis (MTB) is exceptionally successful pathogen with unique characteristic features which make it highly pathogenic [1]. Cell wall of MTB is composed of 60% of lipids. Major fraction of its cell wall is mycolic acid, Cord factor, and Wax-D [2, 3]. The cell wall of MTB is composed of two segments: outer part and core of cell wall (Figure 1). Core of cell wall is made up of peptidoglycan (PG), covalently attached with arabinogalactan (AG) and mycolic acids subsequently, forming the mycolyl arabinogalactan-peptidoglycan (mAGP) complex. Upper part is composed of free lipids which are linked with fatty acids. Mostly this part is made up of different cell wall proteins, the phosphatidylinositol mannosides (PIMs), Lipomannan (LM), and Lipoarabinomannan (LAM). These proteins along with lipids and glycoconjugate lipids act as effector molecules of signaling process, and the insoluble core is essential for the viability of the cell [3]. LAM blocks phagosomal maturation in host cell either by blocking the trafficking pathway from trans-Golgi network (TGN) to phagosomes which itself depends on early endosomal autoantigen 1 (EEA1), an essential Rab5 factor recruitment to early phagosomes, or by inhibiting the Ca2+ concentration in macrophages, as Ca2+ is an essential factor for phagosomal maturation [4]. Another virulence factor, produced by MTB, is Cord factor. Cord factor behaves differentially according to its localization. It is nontoxic, when present on organisms and protects them from macrophage destruction, but it becomes toxic on lipid surfaces. TDM inhibits the phagosome-lysosome fusion and contributes to the maintenance of granulomatous response. Removal of surface lipids enhances trafficking of organisms to acidic compartments [5]. Accumulation of TDM causes weight loss in organisms, resulting in the condition known as Cachexia. In this condition, animals exhibit hypertriglyceridemia, hypoglycemia, and Tumor- Necrosis factor (TNF) in plasma [6]. MTB produces diversity of lipids which are responsible for its pathogenicity.
2. Lipoarabinomannan (LAM)
Lipoarabinomannan commonly known as LAM, is a glycoconjugate and one of the virulence factor associated with MTB. It is a major cell wall component and allows the MTB to survive in host cell environment by affecting host resistance and immune responses [7]. LAM inhibits T-cell proliferation and bactericidal activities of macrophages [8]. In addition, LAM eliminates cytotoxic oxygen-free radicals produced by macrophages and inhibits the activity of protein kinase C and also blocks the activation of gamma-interferon at transcriptional level [8]. LAM is capped with short mannose containing oligosaccharides which allow the bacteria to bind with the mannose receptors present on the macrophages. LAM also has ability to bind with the toll receptors and thus can insert itself into biological membranes affecting signaling events [3]. LAM causes the release of TNF in vitro in human blood monocytes and in vivo in mice. TNF release may be responsible for the characteristics of tuberculosis, such as, loss in weight, fever, and cytokine-mediated necrosis [9]. It was also observed that LAM binds to the DC-SIGN molecule which is expressed on the surface of dendritic cells.
DC-SIGN is indispensable for the maturation of dendritic cells, but binding of LAM inhibits the process. This inhibition also results in decreased IL-12 production and induction of dendritic cells to secrete IL-10, which in turn inhibits antigen presentation, expression of MHC molecules, and costimulatory receptors. In view of these observations recent studies also found that TB patients exhibit considerably elevated levels of IL-10 [10]. This can be demonstrated in vitro by the inhibition of polyethylene glycol- (PEG-) induced lipid vesicle fusion with Fluorescence resonance energy transfer (FRET). PEG absorbs water molecules around the lipid vesicles and promotes fusion of these vesicles. Lower FRET signals are obtained with LAM, which shows that LAM inhibits the association of adjacent vesicles. Instead of Polyethylene glycol (PEG), SNARE proteins act as fusion attachment receptors in vivo [11].
LAM is virulent in nature and causes phagosome maturation arrest by blocking Ca2+/Calmodulin phosphatidyl-inositol-3-kinase hvps34 pathways resulting in the long-term survival of MTB in host cell environment [12].
2.1. Structure
LAM is mainly made-up of three components: membrane anchor, mannosyl-phosphatidyl-myo-inositol, backbone, mannopyranose, and arabinofuranose which are homopolysaccharides and the capping motif. Membrane anchor attaches the molecule to cell wall at the time of infection, and homopolysaccharides serve as carbohydrate skeleton [13, 14].
2.2. Classification of LAM
Classification of LAM is based on the presence and structure of capping and classified LAMs into three major classes.
2.2.1. Mannosylated LAMs (Man LAM)
In Man LAMs, mannosyl groups are present on the D-arabinan group. After the mannosyl capping, Man LAM acts as anti-inflammatory molecule and inhibits the production of TNF-α and IL-12. These properties of Man LAM allow the bacteria to survive in the host cell for long time. Man LAMs are mainly found in pathogenic mycobacterial species such as MTB, Mycobacterium leprae (M. leprae), and Mycobacterium bovis (M. bovis) [15].
2.2.2. Phosphoinositol-Capped LAM (PILAM)
LAMs capped with phosphoinositol groups are called as PILAMs, mainly found in nonpathogenic species such as Mycobacterium smegmatis (M. smegmatis). PILAMs can bind with CD14 receptor, present on macrophages. CD14 receptor is associated with toll like receptor 2 (TLR 2) which acts as recognition receptor for PILAMs. PILAMs induce the production of cytokines such as TNF-alpha, IL-8, and IL-12 [16].
2.2.3. Arabinofuranosyl-Terminated LAM (Ara LAM)
Ara LAM 1, 3-mannosyl side chains are present instead of 1, 2-mannosyl side chain, commonly found in many mycobacterial species. Ara LAM also induces the production of many cytokines such as TNF-alpha, IL 1-alpha, IL 1-β, IL-6, IL-8, and IL-10. Ara LAM is generally found in Mycobacterium chelonae (M. chelonae) and laboratory strains, M. tuberculosis H37Ra [15].
2.3. Biosynthesis of LAM
Many other lipid components of bacterial cell wall like LM and PIMs are involved in the synthesis of LAM. LAM is synthesized by the addition of mannopyranosyl to a phosphoinositol. PIMs are considered as precursors of LAMs in the biosynthesis pathway [9]. PIMs and LM are synthesized by the addition of mannopyranosyl to a phosphoinositol. Glycosylation of PIMs and LM with arabinan forms LAM. Mannosyltransferases are involved in the synthesis of PIMs encoded by the different genes as shown in Table 1. PIMs have been recognized as the major nonpeptidic Antigens of the host immune responses. PIMs are also TLR-2 agonists and are involved in the stimulation of unconventional αβ T lymphocytes in the perspective of CD-1 proteins. PIMs contribute in the opsonic and nonopsonic binding of MTB to phagocytic and nonphagocytic cells, since it is recognized by the C-type lectins, mannose receptor (MR), mannose binding protein (MBP), and DC-SIGN. Degree of mannosylation of PIMs and their fatty acyl appendages are crucial to their interactions with host cells [17].
Mannosyl transferase, Pim A transfers one ManP group to the 2-position of the myo-inositol of PI, which is now converted in PIM1. Pim B transfers one ManP group to the 6 position of the myoinositol of PIM1 to form PIM2. PimA and Pim B both use GDP-Mannose as the sugar donor. Pim C transfers another group of ManP to PIM2 to form PIM3, using GDP-mannose as the sugar donor. Higher PIMs are formed by the further mannosylation of PIM3 with different mannosyl transferases. These PIMs are precursors for the synthesis of LM and LAM as shown in Figure 2. LM is glycosylated with arabinan to form LAM [18].
PimF is involved in the synthesis of higher PIMs and involved in a later step of PIM synthesis. PimF transfers two sequential mannose group to AC4PIM5, resulting in the synthesis of AC4PIM7, an intermediate in the biosynthetic pathway of LAM. Mutation in PimF gene causes accumulation of AC4PIM5 but the synthesis of Pim6 species is not affected. Acylation of Pim1 and Pim2 is mediated by Rv2611c, an acyltransferase [20].
2.4. Maturation of Phagosomes into Phagolysosomes
Phagosomal maturation is a biological process in which phagosomes interact with endosomes and lysosomes. The membrane removed at the time of maturation of phagosomes into phagolysosomes. Maturing phagosomes form phagolysosomes which are essential for the destruction of foreign particles. Late endosomal and lysosomal constituents delivered to phagosomes via various sorting pathways [21, 22]. Two specific rab5 factors are essential for the maturation of phagosomes; (a) the phosphatidyl-inositol (PI) 3 kinase hvps34 and (b) early endosome autoantigen (EEA) [23], which interacts with endosome via its phosphatidyl-inositol-3-phosphate binding domain. These rabs are active when present in GTP-bound state and inactive when present in GDP-bound state. Replacement of rab5 by rab7 is essential for the maturation of phagosomes. The contents of early stage of phagosomes delivered to the late phagosomes via vesicular and intracellular membrane trafficking [24]. EEA1 binds with phagosomes by interacting with PI3P which is generated on early stage of phagosomes by the rab5 effector hvps34 [25]. Additional elements such as Rabaptin-5 [26], tuberin (a Rab5-GTPase activating protein) [27], Rabex 5 (a Rab 5 nucleotide exchange factor) [28] also participate in membrane tethering and fusion. EEA1 causes membrane fusion via interacting with the SNARE syntaxin 13, SNARE priming factor NSF, and alpha-SNAP, essential for the membrane-tethering and fusion [29].
2.5. LAM Causes Phagosome Maturation Arrest
LAM contributes to MTB's pathogenicity by blocking the phosphatidyl-inositol-3-kinase- and phosphatidylinositol-3-phosphate-dependent pathways, resulting in blocking of phagosome maturation [30]. LAM inhibits the recruitment of EEA1 to the early phagosome which is an essential factor for the maturation of phagosomes. LAM also inhibits Ca2+ increase which is required for the Ca2+/Calmodulin-PI3K hvps34 pathways, essential for the PI3P production. PI3P acts as a mediator for the association of phagosome and lysosome via EEA1 rab5 factor. An increase in the concentration of Ca2+ prolongs the binding of Ca2+/Calmodulin to CAMK II, a Serine/Threonine Kinase essential for the EEA1 recruitment to phagosome [5].
Apart from this, a coat protein, TACO, also inhibits the delivery of phagosomal contents to lysosomes, thus prevents the lysosomal delivery of mycobacteria and allow mycobacteria to survive in host macrophages for long time. TACO is formed around the phagosomes after infection [31].
3. Cord Factor (Trehalose 6, 6′-di-mycolate; TDM)
Cord factor is the most abundant glycolipid in the mycobacterial cell wall [32], one of the major constituent of MTB cell wall, is toxic to mammalian cells, and affects the host immune system by inhibiting the migration of polymorphonuclear neutrophils [33]. Cord factor has long chain lipids as structural component of the hydrophobic cell wall which is found to be crucial for the survival of mycobacteria within phagosomes of host [34]. Cord factor is responsible for the specific microscopic morphology called serpentine cords [35].
3.1. Structure
Cord factor molecules are made up of trehalose sugar which is esterified to two mycolic acid residues. Length of the residues can vary from species to species but generally these are present in the range of 20–80 carbons [36]. Two molecules of mycolic acids and one molecule of the disaccharide trehalose are obtained from alkaline hydrolysis of cord factor [37].
3.2. TDM Inhibits Fusion between Phospholipid Vesicles: Like Phagosomes and Lysosomes
TDM consists of trehalose which is attached to hydrophobic components. So, TDM inhibits fusion between two phospholipids bilayers by immobilizing the trehalose at the aqueous interphase. It acts as a barrier to fusion by increasing hydration force and creating a steric hindrance to fusion [38–41]. It has been proved that intact cord factor is required for the inhibition of fusion of phospholipid vesicles, as the free mycolic acid molecules and free trehalose are not able to inhibit fusion of vesicles [36].
In addition, cord factor also stimulates NADase activity in host cell, thus lowering the level of NAD, especially in liver, lung, and spleen. As a result, it reduces the activity of NAD-dependent enzymes. Oxidative phosphorylation and electron transport chain in mitochondria are also affected by the cord factor-mediated disruption of mitochondrial membranes [42].
3.3. Unique Biological Behavior of Cord Factor
Biological activities of Cord factor are dependent on its physical conformation. Cord factor is amphiphilic by nature and it forms micelles in aqueous medium and monolayer on hydrophobic surfaces. In monolayer formation, trehalose and mycolate domains are arranged in two dimensions and form crystal structure [43–45]. The outer surface of micelle is completely made-up of trehalose molecules which make it hydrophilic, and mycolate groups are covered in inner part of micelle [46]. Both micellar and monolayer forms have different biological properties. In micellar form, TDM is nontoxic but in monolayer configuration, it becomes highly toxic. As soon as macrophages come in contact with them, they are killed by mycobacterium [47]. TDM also acquire distinctive immunostimulatory activity, such as humoral responses, granulomagenesis, adjuvant activity for cell-mediated immune responses, and tumor regression [32].
3.4. Host Immune System versus TDM
TDM induces host immune system to secrete cytokines as immune response. Initially macrophages are present in their resting stage. After phagocytosis of bacilli, they gain activity. CD4 and CD8 T-cells are responsible for the immune response of host cells against MTB infection. Macrophages act as antigen presenting cells and interact with CD4 T-cells. CD4 T-cells release IFN-γ after this interaction, which stimulates macrophages for the release of cytokines such as TNF-α, IL-1, IL -1β, IL-12, and IL-6. Host macrophages produce higher amount of proinflammatory cytokines, when exposed to TDM. These cytokines are essential for the formation of granulomas. It also induces chemokine production like as MCP-1 and MIP-1α [48]. In a study it was also proposed that TDM can also be converted into glucose mono mycolate (GMM) inside host cell [49]. In a biochemical study, it has been postulated that TDM is a direct Mincle ligand. Based on this observation, a study was carried out to show that mycobacteria causes conversion of TDM into GMM upon infection into host in order to escape from Mincle- mediated host immunity [50].
3.5. Viability of MTB in Host Macrophages
Petroleum ether methods are used to remove TDM from virulent M. tuberculosis and MTB becomes delipidated [34]. Delipidated MTB is less viable than native MTB. Survival of MTB in macrophages is reduced after delipidation. Cells which are infected with delipidated MTB produce less amount of IL-1β, IL-6, TNF-alpha, and IL-12 but higher amount of IL-10. MCP-1 and MIP-1 alpha production is also delayed after delipidation. Viability of MTB can be restored after addition of pure TDM [56]. Role of TDM in different forms of TB is described in Table 2.
3.6. Cachexia
Cachexia is caused by accumulation of TDM in body in which body weight is reduced even on consuming a proper diet by the animal. Cachectin (TNF) mediates this condition [5]. In this condition, animals lost ability to produce granulomas and die of hemorrhagic pneumonia [57, 58].
4. Conclusion
Mycobacterial lipids have a major role in pathogenicity of MTB. This paper presents evidence that LAM inhibits phagosome maturation and TDM inhibits fusion between phospholipid vesicles (phagosomes and lysosomes). Therefore, it is responsible for the long time survival of MTB in host body. Because of the presence of these unique characteristics features, MTB is highly pathogenic. As we all know that these are not the only factors which provide virulence to MTB. MTB has a plethora of defense mechanisms against host immune system and virulence so targeting a single drug target cannot be a good strategy against MTB infection. Drug resistance is causing another problem in the way of effective treatment of TB, so we should always look for newer drug targets and we can take advantage of the virulence mechanism of LAM and cord factor in the development of new drugs. Further research and investigations may lead to a better understanding for tuberculosis and be helpful in controling it effectively.
Acknowledgments
The authors thank Dr. Rajesh S. Gokhale for making this work possible. The authors acknowledge financial support from GAP0050 of the DST (Department of Science and Technology) and CSIR (Council of Scientific & Industrial Research).
AbbreviationsMTB:
Mycobacterium tuberculosis
LAM:
Lipoarabinomannan
TDM:
Trehalose di-mycolate
TACO:
Tryptophane aspartate-containing coat protein
FRET:
Fluorescence resonance energy transfer
PI:
Phosphatidyl-myo-inositol
PIM:
Phosphatidylinositol mannoside
LM:
Lipomannan
TGN:
Trans-Golgi network
EEA1:
Early endosomal autoantigen 1
MHC:
Major histocompatibility complex.
BrennanPJNikaidoHThe envelope of mycobacteriaAnnual Review of Biochemistry1995642963AlderwickLJBirchHLMishraAKEggelingLBesraGSStructure, function and biosynthesis of the Mycobacterium tuberculosis cell wall: arabinogalactan and lipoarabinomannan assembly with a view to discovering new drug targetsBiochemical Society Transactions20073551325132817956343BrennanPJStructure, function, and biogenesis of the cell wall of Mycobacterium tuberculosisTuberculosis2003831–3919712758196VergneIChuaJDereticVTuberculosis toxin blocking phagosome maturation inhibits a novel Ca /calmodulin-PI3K hVPS34 cascadeJournal of Experimental Medicine2003198465365912925680SilvaCLFaccioliLHTumor necrosis factor (cachectin) mediates induction of cachexia by cord factor from mycobacteriaInfection and Immunity19885612306730713053451HunterRLOlsenMRJagannathCActorJKMultiple roles of cord factor in the pathogenesis of primary, secondary, and cavitary tuberculosis, including a revised description of the pathology of secondary diseaseAnnals of Clinical and Laboratory Science200636437138617127724GuérardelYMaesEBrikenVLipomannan and lipoarabinomannan from a clinical isolate of Mycobacterium kansasii: novel structural features and apoptosis-inducing propertiesJournal of Biological Chemistry200327838366373665112829695KnutsonKLHmamaZHerrera-VelitPRochfordRReinerNELipoarabinomannan of Mycobacterium tuberculosis promotes protein tyrosine dephosphorylation and inhibition of mitogen-activated protein kinase in human mononuclear phagocytes: role of the Src homology 2 containing tyrosine phosphatase 1Journal of Biological Chemistry199827316456529417127CotranRSKumarVRobbinsSLPathologic Basis of Disease19894Philadelphia, Pa, USAW. B. SaundersDietrichJDohertyTMInteraction of Mycobacterium tuberculosis with the host: consequences for vaccine developmentAPMIS20091175-644045719400867HayakawaETokumasuFNardoneGAJinAJHackleyVADvorakJAA Mycobacterium tuberculosis-derived lipid inhibits membrane fusion by modulating lipid membrane domainsBiophysical Journal200793114018403017704144MalikZADenningGMKusnerDJInhibition of Ca signaling by Mycobacterium tuberculosis is associated with reduced phagosome-lysosome fusion and increased survival within human macrophagesJournal of Experimental Medicine2000191228730210637273ChatterjeeDKhooKHMycobacterial lipoarabinomannan: an extraordinary lipoheteroglycan with profound physiological effectsGlycobiology1998821131209451020NigouJGilleronMPuzoGLipoarabinomannans: from structure to biosynthesisBiochimie2003851-215316612765785GilleronMHimoudiNAdamOMycobacterium smegmatis phosphoinositols-glyceroarabinomannans: structure and localization of alkali-labile and alkali-stable phosphoinositidesJournal of Biological Chemistry199727211171248995236VignalCGuérardelYKremerLLipomannans, but not lipoarabinomannans, purified from Mycobacterium chelonae and Mycobacterium kansasii induce TNF-α and IL-8 secretion by a CD14-Toll-like receptor 2-dependent mechanismJournal of Immunology2003171420142023GuerinMEKordulakovaJAlzariPMBrennanPJJacksonMMolecular basis of phosphatidylinositol mannoside biosynthesis and regulation in mycobacteriaJournal of Biological Chemistry2010285335773358320801880KremerLGurchaSSBifaniPCharacterization of a putative α-mannosyltransferase involved in phosphatidylinositol trimannoside biosynthesis in Mycobacterium tuberculosisBiochemical Journal2002363343744711964144KordulákováJGilleronMMikuováKDefinition of the first mannosylation step in phosphatidylinositol mannoside synthesis: PimA is essential for growth of mycobacteriaJournal of Biological Chemistry200227735313353134412068013AlexanderDCJonesJRWTanTChenJMLiuJMannosyltransferase of mycobacteria, is involved in the biosynthesis of phosphatidylinositol mannosides and lipoarabinomannanJournal of Biological Chemistry200427918188241883314960574MéresseSSteele-MortimerOMorenoEDesjardinsMFinlayBGorvelJPControlling the maturation of pathogen-containing vacuoles: a matter of life and deathNature Cell Biology199917E183E188VieiraOVBotelhoRJGrinsteinSPhagosome maturation: aging gracefullyBiochemical Journal2002366368970412061891VoliniaSDhandRVanhaesebroeckBA human phosphatidylinolsitol 3-kinase complex related to the yeast Vps34p-Vps15p protein sorting systemEMBO Journal19951414333933487628435RinkJGhigoEKalaidzidisYZerialMRab conversion as a mechanism of progression from early to late endosomesCell2005122573574916143105ChristoforidisSMiaczynskaMAshmanKPhosphatidylinositol-3-OH kinases are Rab5 effectorsNature Cell Biology199914249252StenmarkHVitaleGUllrichOZerialMRabaptin-5 is a direct effector of the small GTPase Rab5 in endocytic membrane fusionCell19958334234328521472XiaoGHShoarinejadFJinFGolemisEAYeungRSThe tuberous sclerosis 2 gene product, tuberin, functions as a Rab5 GTPase activating protein (GAP) in modulating endocytosisJournal of Biological Chemistry199727210609761009045618HoriuchiHLippéRMcBrideHMA novel Rab5 GDP/GTP exchange factor complexed to Rabaptin-5 links nucleotide exchange to effector recruitment and functionCell1997906114911599323142McBrideHMRybinVMurphyCGinerATeasdaleRZerialMOligomeric complexes link Rab5 effectors with NSF and drive membrane fusion via interactions between EEA1 and syntaxin 13Cell199998337738610458612FrattiRABackerJMGruenbergJCorveraSDereticVRole of phosphatidylinositol 3-kinase and Rab5 effectors in phagosomal biogenesis and mycobacterial phagosome maturation arrestJournal of Cell Biology2001154363164411489920FerrariGLangenHNaitoMPietersJA coat protein on phagosomes involved in the intracellular survival of mycobacteriaCell199997443544710338208HunterRLOlsenMRJagannathCActorJKMultiple roles of cord factor in the pathogenesis of primary, secondary, and cavitary tuberculosis, including a revised description of the pathology of secondary diseaseAnnals of Clinical and Laboratory Science200636437138617127724AsanoMNakaneAMinagawaTEndogenous gamma interferon is essential in granuloma formation induced by glycolipid-containing mycolic acid in miceInfection and Immunity1993617287228788514390IndrigoJHunterRLActorJKInfluence of trehalose 6,6′-dimycolate (TDM) during mycobacterial infection of bone marrow macrophagesMicrobiology200214871991199812101287MiddlebrookGDubosRGPierceCVirulence and morphological characteristics of mammalian tubercle bacilliJournal of Experimental Medicine19478617518419871665SpargoBJCroweLMIonedaTBeamanBLCroweJHCord factor (α,α-trehalose 6,6'-dimycolate) inhibits fusion between phospholipid vesiclesProceedings of the National Academy of Sciences of the United States of America19918837377401992465NollHBlochHAsselineauJLedererEThe chemical structure of the cord factor of Mycobacterium tuberculosisBiochimica et Biophysica Acta19562029931813328853ParsegianVAFullerNRandRPMeasured work of deformation and repulsion of lecithin bilayersProceedings of the National Academy of Sciences of the United States of America197976627502754288063RandRPParsegianVAPhysical force considerations in model and biological membranesCanadian Journal of Biochemistry and Cell Biology19846287527596498591CowleyACMeasurement of repulsive forces between charged phospholipid bilayersBiochemistry1978171531633168698192MarshDWater adsorption isotherms and hydration forces for lysolipids and diacyl phospholipidsBiophysical Journal1989556109311002765647GorenMBBrennanPJYoumansGPMycobacterial lipids: chemistry and biological activitiesTuberculosis1980Philadelphia, Pa, USAW. B. Saunders63193RetzingerGSMeredithSCTakayamaKThe role of surface in the biological activities of trehalose 6,6’-dimycolate. Surface properties and development of a model systemJournal of Biological Chemistry198125615820882167263645SchabbingRWGarciaAHunterRLCharacterization of the trehalose 6,6’-dimycolate surface monolayer by scanning tunneling microscopyInfection and Immunity19946227547568300239BehlingCABennettBTakayamaKHunterRLDevelopment of a trehalose 6,6’-dimycolate model which explains cord formation by Mycobacterium tuberculosisInfection and Immunity1993616229623038500871RetzingerGSMeredithSCHunterRLIdentification of the physiologically active state of the mycobacterial glycolipid trehalose 6,6'-dimycolate and the role of fibrinogen in the biologic activities of trehalose 6,6'-dimycolate monolayersJournal of Immunology19821292735744YoumansGPYoumansGPMycobacterial lipids: chemistry and biologic activitiesTuberculosis1979Philadelphia, Pa, USAW. B. Saunders63193ActorJKLeonardCDWatsonVECytokine mRNA expression and serum cortisol evaluation during murine lung inflammation induced by Mycobacterium tuberculosisCombinatorial Chemistry and High Throughput Screening20003434335110974146MatsunagaINakaTTalekarRSMycolyltransferase-mediated glycolipid exchange in mycobacteriaJournal of Biological Chemistry200828343288352884118703502IshikawaEIshikawaTMoritaYSDirect recognition of the mycobacterial glycolipid, trehalose dimycolate, by C-type lectin MincleJournal of Experimental Medicine2009206132879288820008526PagelWPagelWFat and lipoid content of tuberculous tissue-histochemical investigationVirchow's Archiv für pathologische Anatomie1925256629640HatipoğluONOsmaEManisaliMHigh resolution computed tomographic findings in pulmonary tuberculosisThorax19965143974028733492KurasawaTIkedaNYamadoriHTwo cases of elderly people diagnosed with acute tuberculous pneumonia possibly succeeded by the perforation of lymph nodes in the bronchusKekkaku199469283888126993SoniRBarnesDTorzilloPPost obstructive pneumonia secondary to endobronchial tuberculosis—an institutional reviewAustralian and New Zealand Journal of Medicine199929684184210677139HunterRLOlsenMJagannathCActorJKTrehalose 6,6′-dimycolate and lipid in the pathogenesis of caseating granulomas of tuberculosis in miceAmerican Journal of Pathology200616841249126116565499IndrigoJHunterRLActorJKCord factor trehalose 6,6′-dimycolate (TDM) mediates trafficking events during mycobacterial infection of murine macrophagesMicrobiology200314982049205912904545RetzingerGSDissemination of beads coated with trehalose 6,6’-dimycolate: a possible role for coagulation in the dissemination processExperimental and Molecular Pathology19874621901983556532SeggevJSGorenMBKirkpatrickCHThe pathogenesis of trehalose dimycolate-induced interstitial pneumonitis. III. Evidence for a role for T-lymphocytesCellular Immunology19848524284356609001
Different genes involved in the biosynthesis of LAM.
Name of gene
Function
Family
Group
References
Pim A
Conversion of PI into PIM1
(According to the classification of glycosyltransferases) 4
(According to the Pfam data base) 1
Pim B
Conversion of PIM1 into PIM2
[19]
Pim C
Conversion of PIM2 into PIM3
Pim F
Conversion of AC4PIM5 into AC4PIM7
2
2
[20]
Role of TDM in different forms of TB.
Type of tuberculosis
Role of TDM
References
Primary tuberculosis
(1) For survival of MTB in host cell environment mainly in macrophages by inhibiting phagosome-lysosome fusion.
[50]
(2) At the time of caseating granulomas formation, a sufficient dose of TDM is required.
[5]
Secondary tuberculosis
(1) Preliminary stage of secondary tuberculosis is called as lipid pneumonia, which is caused by the infected material spilled from granuloma cavities.
[51]
(2) Due to the presence of TDM, MTB is able to survive in foamy alveolar macrophages.
(3) Bronchial obstruction takes place either because of granuloma or lipid content present on MTB cell wall.
[52–54]
Caseation necrosis
(1) TDM monolayer triggers caseation necrosis in MTB.
[55]
(2) Toxic effects of TDM contribute to the maintenance of the lesions.
oai:pubmedcentral.nih.gov:30394562011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30394562135065810.4061/2011/238456Research ArticleImprovement of Physiological Characteristic of Selenium-Enriched Candida utilis with Amino Acids AdditionXiaoguangGeDahuiWangGongyuanWei*MinNieNaShaoSchool of Basic Medicine and Biological Science, College of Medicine, Soochow University, Suzhou 215123, China*Wei Gongyuan: weigy@suda.edu.cn
The effects of amino acids addition on cell growth, glutathione biosynthesis, glutathione distribution, and the intracellular oxidation-reduction environment of Candida utilis SZU 07-01 during selenium enrichment were investigated in this study. Most amino acids under appropriate concentrations have positive effects on cell growth of the yeast strain, except for phenylalanine and proline, compared with the control without amino acid addition. The bioconversion of selenite to organic selenium induced the reduction of glutathione synthesis and intracellular distribution of glutathione. However, amino acids including cysteine, glutamine, glutamic acid, isoleucine, leucine, and tyrosine could effectively promote the selenium-enriched yeast to elevate glutathione production, especially increasing the intracellular glutathione content. Moreover, addition of these six different amino acids apparently decreased malondialdehyde concentration and recovered the normal intracellular redox environment of the selenium-enriched C. utilis SZU 07-01. The improvement of physiological characteristic of the selenium-enriched yeast by increasing intracellular glutathione content and lowering malondialdehyde content will undoubtedly help to widen application of selenium-enriched yeast as food or feed additives.
1. Introduction
Selenium is an essential nutritional trace element for many mammalian species including human beings owing to its critical role involved in cell metabolism [1]. Selenium is also an essential component of the active site of selenoenzyme glutathione peroxidase [2]. This enzyme, together with catalase and superoxide dismutase, protects cells against damages caused by free radicals and lipid peroxides [3]. Selenium is now being widely studied for its cancer chemopreventive activity and antioxidative property [4], and it also has a profound effect on survival of HIV-infected patients [5]. In mammals, selenium deficiency has been associated with human diseases including muscular, neurological, and immune disorders, and also with increased cancer incidence and mortality [1, 6].
The deficiency of selenium in the diet is compensated for supplementation [7]. However, selenium can be either essential or toxic depending on its chemical form and concentration, and its safety and efficacy may also be markedly dynamic because of differential metabolic processing by different organs. It is generally believed that the ingestion of organic selenium compounds is better and safer than that contained inorganic selenium [8]. Many organic and inorganic selenium materials have been investigated as selenium supplements. Among them, supplementation by using selenium-enriched microorganisms has received much attention in recent years [9]. Researchers have found that yeast is a good carrier for selenium biotransformation. Under appropriate conditions, yeast is capable of producing biomass with high protein content and meanwhile accumulating large amount of trace elements such as selenium, and transforming inorganic selenium (low bioavailability, potentially toxic) into organic form (safer and highly bioactive), mostly in the form of selenomethionine [8].
In June 2000, selenium-enriched yeast was approved by FDA as a source for feed-supplemented organic selenium for chickens [10], which can also provide antioxidant protection at a level greater than inorganic selenium for chickens and other livestock [11]. Organic selenium from selenium-enriched yeast has been applied to the improvement of meat quality [12], growth of feathers [13], and positive influence of thyroxine conversion to tri-iodothyronine and passive immunity of newborn lambs [14]. Hence, the commercial demand for selenium-enriched yeast in the future will increase gradually.
Glutathione, a low-molecular thiol compound found in most plants, animals and microorganisms, fulfills its roles in many cellular processes including the protection of DNA, proteins, and other biomolecules against oxidative damage caused by reactive oxygen species [15]. Glutathione has elicited many interests in the fields of medical treatment, health care, therapeutics, sports nutrition, feed additive and cosmetics industry [16]. Glutathione can be synthesized by chemical method, enzymatic reaction, and microorganism fermentation [17]. Among these methods, yeast fermentation is more efficient and practical. Microorganisms such as Saccharomyces cerevisiae and Candida utilis are commonly used for fermentative production of glutathione [18, 19].
Based on the physiological function of glutathione on living organisms, the application of selenium-enriched yeast will be greatly expanded if the yeast contained glutathione intracellularly. However, most previous works on selenium-enriched yeast were carried out by S. cerevisiae, in which low yield of biomass and conversion rate of inorganic selenium were major obstacles for successful commercialization of this microorganism in the health food and feed industry [9]. So, we paid close attention to screening other industrial used yeast of C. utilis for selenium-enriched yeast preparation, and have found that C. utilis has a higher conversion rate from inorganic selenium to organic form, together with less ethanol formation during the cultivation [20]. Before our studies, few reports were focused on this aspect to date, nor with the quality improvement of selenium-enriched C. utilis. Moreover, the intracellular glutathione content in yeast cells was rarely explored although total selenium content was more concerned. Here, we investigated the effects of amino acids addition on the preparation of selenium-enriched C. utilis, with special emphasis on the enhancement of intracellular glutathione content of the selenium-enriched yeast in order to improve its application as food or feed additives.
2. Materials and Methods2.1. Yeast Strain and Medium
C. utilis SZU 07-01, a strain which can produce glutathione intracellularly together with great ability to absorb selenium, was used in this study. The yeast strain was maintained at 4°C by being monthly subcultivated on the slant with seed medium (20 g/L glucose, 20 g/L peptone and 10 g/L yeast extract, pH 6.0) and 20 g/L agar.
2.2. Culture Method
The seeds were prepared by transferring colonies from a fresh agar slant into 500 mL Erlenmeyer flasks containing 50 mL seed medium, and incubated at 30°C for 20 hours on a rotary shaker with an agitation rate of 200 rpm. Then the culture was inoculated at 10% (v/v) into the fermentation broth. Unless stated otherwise, the medium for fermentation contained glucose (30 g L−1), ammonium sulfate (8 g L−1), KH2PO4 (3 g L−1), MgSO4 (0.25 g L−1), Na2SeO3 (0.01 g L−1), with an initial pH of 5.5. The preparation of Se-enriched yeast was carried out in 500 mL flasks containing 40 mL fermentation medium, and the culture conditions were fixed at 27°C, 200 rpm and 30 h, respectively [20]. The medium was steam-sterilized except for Na2SeO3, which was microfiltered by a Sartorious membrane with the pore size of 0.20 μm.
2.3. Amino Acids Addition in Flasks
Each amino acid was added to the fermentation broth at the beginning of cultivation (0 hour), and the addition concentration of each amino acid shifted from 2 mmol L−1 to 16 mmol L−1. The concentrated amino acid solution was also microfiltered by a Sartorious membrane with the pore size of 0.20 μm. All amino acids added in this work are L-isomers, hence we omit “L-” for each amino acid in the following text.
2.4. Analytical Methods
A culture broth of 25 mL was centrifuged at 8, 000 × g for 10 minutes, and after washed twice with distilled water, the wet cells were dried at 70°C to a constant weight for dry cell weight (DCW) determination. Glutathione was extracted from the wet cells by 40% (v/v) ethanol solution at 30°C for 2 hours, then centrifuged at 8, 000 × g for 15 minutes, the supernatant was used for glutathione assay. Glutathione concentration was determined using DTNB and glutathione reductase according to the method described by Tietze [21]. The intracellular glutathione content (IGC) of selenium-enriched yeast was defined as follows:
Wet cells from a 5 mL culture broth were washed twice with deionized water, after centrifuged at 8, 000 × g for 15 minutes, the cells were digested in 10 mL concentrated nitric acid and perchloric acid (v : v = 4 : 1) at 100°C for 10 minutes. To avoid the volatilization loss of selenium, one reflux equipment was employed during the digestion process. The digested samples were diluted to a final volume of 50 mL with 0.1 mol L−1 HCl, filtered with a Sartorious membrane with the pore size of 0.20 μm, and the concentration of total selenium was determined with a catalytic spectrophotometry followed with the method previously described by Hao and Teng [22].
Wet cells from a 10 mL fermentation broth were washed three times with deionized water, then mixed with 5 mL ultrapure water and boiled at 100°C for 1 hour, the supernatant was assayed for the intracellular inorganic selenium. Organic selenium was calculated from the difference between the total selenium and inorganic selenium.
Glucose was determined by the DNS spectrometric method [23], and malondialdehyde (MDA) was determined by TBA assay [24]. The results shown from the flasks represent an average of three parallel experiments.
3. Results3.1. Effect of Selenium Enrichment on Batch Culture of <italic>C. utilis</italic> SZU 07-01
The preparation of selenium-enriched yeast by cultivation of C. utilis SZU 07-01 was carried out in flasks, followed with the optimal nutrimental and environmental conditions as described in our previous study [20]. Under this circumstance, more than 90% of inorganic selenium was assimilated by the yeast and transformed into organic selenium. However, several parameters altered dramatically compared with the process without selenium enrichment (Table 1). For instance, DCW, total glutathione and intracellular glutathione content decreased by 10%, 47% and 84%, respectively. It is well known that higher intracellular glutathione content can boost the quality and application area of selenium-enriched C. utilis in food and feed industry [16], since it can fulfill organic selenium supplement together with the improvement of immunity of animals. Therefore, we should take measures such as amino acids addition to improve total glutathione and intracellular glutathione content of the Se-yeast.
3.2. Amino Acid Addition Boosted the Cell Growth of Selenium-Enriched Yeast
Amino acids, the basic units of protein and growth factor, are essential nutrient elements for the life cycle of yeast. Although C. utilis SZU 07-01 can grow well on a synthetic medium just contained glucose, ammonium and ions, it is also shown that the addition of some amino acids is beneficial to cell growth and metabolism of the yeast [25]. Whether amino acids were added or not, glucose in the culture medium was completely consumed, followed that glutathione was biosynthesized intracellularly and selenium was assimilated. As is shown in Table 2, almost all the amino acids added with appropriate concentration have positive effect on cell growth of selenium-enriched C. utilis SZU 07-01 except for Phe and Pro, of which Ala, Gln, Glu, His, Ile and Ser can improve the biomass by 5 ~ 10%, Arg, Leu, Lys, Thr and Val can increase cell growth by 10 ~ 15%. Specially, DCW of selenium-enriched C. utilis SZU 07-01 was elevated by 16% when 8 mmol/L of Asp was added to the medium at the beginning of cultivation.
3.3. Effect of Amino Acids Addition on Glutathione Biosynthesis during Selenium Enrichment
Glutathione is biosynthesized with its precursors (glutamic acid, cysteine and glycine) and ATP, hence the addition of precursor amino acids in accordance with appropriate concentration is associated with increased glutathione biosynthesis. However, the assimilation of selenite by yeast cells will also facilitate the excretion of glutathione to the outer broth. The process of glutathione biosynthesis including total glutathione, intracellular glutathione and extracellular glutathione was investigated when the precursors and other amino acids were added during the preparation of selenium-enriched C. utilis SZU 07-01. It was found in Table 3 that just adding Lys, Phe and Pro have no positive effect on glutathione synthesis when inorganic selenium was biotransformed into organic forms. Other amino acids can increase glutathione yield if they were added in appropriate concentrations. His, Ser, Thr and Try can increase glutathione synthesis by 10 ~ 30%, Arg, Gln, Ile, Leu, Met and Tyr can elevate glutathione by 30 ~ 50%, Ala, Asp and Glu can boost glutathione yield by more than 50%. Specially, cysteine, the key amino acid during glutathione synthesis, has a prominent ability to improve glutathione by 102.7%.
3.4. Effect of Amino Acids Addition on the Distribution of Glutathione
Although many amino acids can boost total glutathione biosynthesis even in the presence of selenite, the intracellular glutathione content after adding different amino acids varied dramatically. It can be calculated from Table 4 that most of amino acids except Asn and Lys had positive effect on intracellular glutathione content of selenium-enriched C. utilis SZU 07-01. Moreover, the tendency of glutathione distribution extracellularly altered opposite to intracellular glutathione content. Among all the amino acids we considered, Cys, Glu, Ile, Leu were helpful in resistance of glutathione leakage to outer broth, and Leu was the most prominent one to promote intracellular glutathione content, together with intracellular distribution of glutathione, when compared with the control without amino acid addition within the process of selenium enrichment by C. utilis SZU 07-01.
3.5. Effect of Amino Acids Addition on the Intracellular Oxidation-Reduction Environment
During selenium enrichment of C. utilis SZU 07-01, more reduced glutathione was excreted to the outer cells and transformed to oxidized form. The decrease in reduced glutathione content may decrease the activities of antioxidant enzymes and so it aggravates the effect of oxidative stress [26]. The intracellular oxidation-reduction environment was represented with the inner concentration of malondialdehyde (MDA) in this study. It was illustrated in Figure 1 that Cys, Gln, Glu, Ile, Leu and Tyr which have significant effects on promoting the intracellular glutathione content and making more glutathione be distributed intracellularly can also apparently reduce MDA concentration and recover the intracellular redox environment of selenium-enriched of C. utilis 07-01. The more intracellular content of glutathione was detected, the less concentration of inner MDA was observed.
4. Discussion
More than 90% of selenium assimilated in selenium-enriched yeast involving C. utilis existed in the form of selenomethionine [8]. The metabolic pathway from selenomethionine to selenocysteine could provide Se-cysteine for the active site of glutathione peroxidase, which could enhance the enzymatic activity and thus promote the oxidation of glutathione. Moreover, selenium of low valence could be oxidized to higher oxidation state by O2, H2O2 and other peroxides, which could produce reactive oxygen species (ROS). ROS and selenium of high valence could be reduced further by glutathione. Therefore, with the biotransformation of selenium, the more selenium was absorbed to inner cells, the less intracellular glutathione was reserved and the more ROS was formed. Besides, selenite could also induce the leakage of glutathione to the outer broth during selenium enrichment [27].
Glutathione is one of the most important compounds in maintaining intracellular thiol status. It performs various functions ranging from cellular metabolism to transport and also protection against oxygen-free radicals [28]. Therefore the reduction of intracellular glutathione content would break the delicate balance between the prooxidant forces and antioxidant defenses which is known as the redox balance. When the antioxidant defenses are overwhelmed by prooxidants, oxidative stress may occur and so aggravate the effects of oxidative stress [26]. Under high oxidative stress, the production and accumulation of lipid peroxidation could be increased due to the increase of ROS. Damage to mitochondria induced by lipid peroxidation can lead to further generation of ROS [29]. In addition, increased lipid peroxidation can lead to the production of MDA that would enhance the formation of free radicals from polyunsaturated fatty acids in cell membranes and cause depletion of glutathione through detoxification by glutathione peroxidase and glutathione S-transferase [30]. Although selenium can induce the synthesis of metallothionein, the damage of matallothionein in scavenging free radicals could not be repaired due to very low level of intracellular glutathione content. Decrease in intracellular thiol will bring alteration of the lipid composition, which in turn may result in disrupting the organization of cell membrane, causing changes in fluidity, permeability and enzyme activities, inhibition of metabolic processes, and alterations of ion transport [31]. This may increase the leakage of glutathione from inner cells to outer broth. According to the results in Table 1, most glutathione was observed to be transferred to extracellular medium during the preparation of selenium-enriched yeast. Iizuka et al. had also found the similar phenomenon with S. cerevisiae [27].
It is well known that the addition of precursors of glutathione can improve the biosynthesis of this tripeptide. Other amino acids such as Met, Tyr and Asp, have positive effects on glutathione formation during selenium enrichment will result from their entering the main pathway after deamination or transamination. Hence the addition of these amino acids to the medium will consequently increase the metabolic flux to glycolysis and citric acid cycle, which, to some extent, would be in favor of excessive biosynthesis of ATP and precursors required for glutathione production. The increase of glutathione synthesis will be undoubtedly helpful to maintain a suitable oxidation-reduction environment together with the recovery of injured cell membrane caused by selenium assimilation. Some amino acids such as Leu and Phe were also beneficial for the stabilization of cell membrane [32], which in turn would reduce the loss of intracellular glutathione.
Glutathione is an important antioxidant for protecting DNA, proteins, and other biomolecules such as metallothionein which has a stronger ability to remove hydroxyl radical than glutathione against oxidative damage by reactive oxygen species [16]. The redox system depended on glutathione had been shown to play an important role in the process against oxygen stress in E. coli and S. cerevisiae, and in maintaining the intracellular redox balance [15]. Adding certain amino acids appropriately as described above could increase intracellular glutathione content and improve distribution proportion of intracellular glutathione which will be helpful to maintain proper redox environment within cells.
Acknowledgments
X. Ge and D. Wang contributed equally to this work. The authors would like to acknowledge the financial support by the National Natural Science Foundation of China (20906065), together with the Natural Science project for Universities in Jiangsu Province (09KJB530009).
RaymanMPThe importance of selenium to human healthLancet2000356922523324110963212RotruckJTPopeALGantherHESwansonABHafemanDGHoekstraWGSelenium: biochemical role as a component of glatathione peroxidaseScience197317940735885904686466FlohéLSelenium and peroxide metabolismMedizinische Klinik1997923579417502KleinEALippmanSMThompsonIMThe selenium and vitamin E cancer prevention trialWorld Journal of Urology2003211212712756490KupkaRMsamangaGISpiegelmanDSelenium status is associated with accelerated HIV disease progression among HIV-1-infected pregnant women in TanzaniaJournal of Nutrition2004134102556256015465747RaymanMPSelenium in cancer prevention: a review of the evidence and mechanism of actionProceedings of the Nutrition Society200564452754216313696RaymanMPDietary selenium: time to actBritish Medical Journal199731470783873889040368SchrauzerGNSelenomethionine: a review of its nutritional significance, metabolism and toxicityJournal of Nutrition200013071653165610867031SuhajdaÁHegóczkiJJanzsóBPaisIVereczkeyGPreparation of selenium yeasts I. Preparation of selenium-enriched Saccharomyces cerevisiaeJournal of Trace Elements in Medicine and Biology2000141434710836533FederalRFood additive permitted in feed and drinking water: selenium yeastFederal Register2000653582335824MahmoudKZEdensFWInfluence of selenium sources on age-related and mild heat stress-related changes of blood and liver glutathione redox cycle in broiler chickens (Gallus domesticus)Comparative Biochemistry and Physiology B20031364921934MateoRDSpallholzJEElderRYoonIKimSWEfficacy of dietary selenium sources on growth and carcass characteristics of growing-finishing pigs fed diets containing high endogenous seleniumJournal of Animal Science20078551177118317264237EdensFWParkhurstCRHavensteinGBSeftonAEHousing and selenium influences on feathering in broilersJournal of Applied Poultry Research2001102128134RockMJKincaidRLCarstensGEEffects of prenatal source and level of dietary selenium on passive immunity and thermometabolism of newborn lambsSmall Ruminant Research200140212913811295395Carmel-HarelOStorzGRoles of the glutathione- and thioredoxin-dependent reduction systems in the Escherichia coli and Saccharomyces cerevisiae responses to oxidative stressAnnual Review of Microbiology200054439461SiesHGlutathione and its role in cellular functionsFree Radical Biology and Medicine1999279-1091692110569624SakatoKTanakaHAdvanced control of glutathione fermentation processBiotechnology and Bioengineering199240890491218601197WeiGYLiYDuGCChenJFermentation conditions of glutathionine by Candida utilisChinese Journal of Applied and Environmental Biology20039642646SantosLOGonzalesTAÚbedaBTAlegreRMInfluence of culture conditions on glutathione production by Saccharomyces cerevisiaeApplied Microbiology and Biotechnology200777476376917926030GeXGWeiGYNieMShaoNStudies on the conditions for preparation of selenium enriched with Candida utilisCereal & Feed Industry2009103133TietzeFEnzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissuesAnalytical Biochemistry19692735025224388022HaoSETengBStudy on determination of selenium in selenium-yeastPercutaneous Transluminal Coronary Angioplasty B199935151153MillerGLUse of dinitrosalicylic acid reagent for determination of reducing sugarAnalytical Chemistry1959313426428WaterfallAHSinghGFryJRMarsdenCADetection of the lipid peroxidation product malonaldehyde in rat brain in vivoNeuroscience Letters1995200169728584270WeiG-YWangD-HChenJOverproduction of glutathione by L-cysteine addition and a temperature-shift strategyBiotechnology and Bioprocess Engineering2008133347353GargMCOjhaSBansalDDAntioxidant status of streptozotocin diabetic ratsIndian Journal of Experimental Biology19963432642668781037IizukaMMurataKKimuraAInduction of glutathione leakage from Saccharomyces cerevisiae cells by seleniteAgricultural and Biological Chemistry198852613614ArrickBANathanCFGlutathione metabolism as a determinant of therapeutic efficacy: a reviewCancer Research19844410422442326380705GreenDRReedJCMitochondria and apoptosisScience19982815381130913129721092AdibhatlaRMHatcherJFDempseyRJPhospholipase A2, hydroxyl radicals and lipid peroxidation in transient cerebral ischemiaAntioxidants and Redox Signaling20035564765414580322AhsanHAliAAliROxygen free radicals and systemic autoimmunityClinical and Experimental Immunology2003131339840412605691HuCKBaiFWAnLJInfluence of protein amino acid composition of plasma membranes of a self-flocculating yeast on its tolerance to etnanol and the mechanismActa Microbiologica Sinica200444636640
Effects of different concentration of amino acids ((a), Leu; (b), Cys; (c), Gln; (d), Glu; (e), Ile; (f), Tyr) addition on intracellular glutathione content and MDA concentration during selenium-enriched C. utilis SZU 07-01 preparation. The control represents batch culture without selenium enrichment; the control (Se) represents batch culture with selenium enrichment but without amino acids addition.
Comparison of parameters on the batch process with and without selenium enrichment.
Parameters
Without selenium enrichment
With selenium enrichment
Dry cell weight (g L−1)
11.26 ± 0.08
10.14 ± 0.06
Intracellular glutathione content (%)
0.89 ± 0.03
0.14 ± 0.03
Extracellular glutathione (mg L−1)
41.3 ± 2.7
60.7 ± 3.2
Total glutathione (mg L−1)
142.0 ± 5.4
74.6 ± 4.6
Yield of selenium biotransformation (%)
0 ± 0.0
90.2 ± 0.6
Effects of amino acids addition on cell growth of selenium-enriched yeast.
Amino acid (mmol L−1)
Dry cell weight (g L−1)
Maximum ratio increased (%)
0
2
4
6
8
10
Asp
10.76 ± 0.04
10.52 ± 0.03
11.36 ± 0.02
11.56 ± 0.02
12.48 ± 0.03
12.25 ± 0.01
16.0
Leu
9.53 ± 0.08
10.30 ± 0.04
10.43 ± 0.03
10.63 ± 0.08
10.90 ± 0.03
10.73 ± 0.08
14.4
Thr
10.35 ± 0.00
10.95 ± 0.05
10.95 ± 0.05
11.55 ± 0.05
11.43 ± 0.08
11.70 ± 0.05
13.0
Val
9.70 ± 0.05
10.00 ± 0.04
10.25 ± 0.02
10.55 ± 0.05
10.95 ± 0.04
10.25 ± 0.01
12.9
Lys
10.23 ± 0.03
10.10 ± 0.05
10.58 ± 0.08
10.75 ± 0.05
11.13 ± 0.03
11.48 ± 0.08
12.2
Arg
9.60 ± 0.02
9.68 ± 0.08
9.90 ± 0.05
9.95 ± 0.02
10.23 ± 0.08
10.65 ± 0.00
10.9
Ser
10.76 ± 0.04
10.98 ± 0.03
11.15 ± 0.03
11.40 ± 0.03
11.73 ± 0.03
11.80 ± 0.05
9.7
Ile
9.53 ± 0.08
9.95 ± 0.05
10.03 ± 0.08
10.13 ± 0.03
10.23 ± 0.03
10.43 ± 0.08
9.4
Gln
9.90 ± 0.05
9.93 ± 0.03
10.00 ± 0.05
10.43 ± 0.03
10.80 ± 0.04
10.73 ± 0.03
9.1
His
9.90 ± 0.06
10.20 ± 0.06
10.49 ± 0.07
10.49 ± 0.03
10.72 ± 0.03
10.69 ± 0.07
8.3
Glu
10.38 ± 0.00
10.07 ± 0.00
10.31 ± 0.01
10.44 ± 0.02
10.94 ± 0.07
11.14 ± 0.01
7.3
Ala
10.76 ± 0.04
10.36 ± 0.03
10.24 ± 0.02
10.80 ± 0.03
10.88 ± 0.05
11.40 ± 0.08
5.9
Tyr
9.60 ± 0.02
9.70 ± 0.10
9.70 ± 0.10
9.65 ± 0.02
9.85 ± 0.05
10.00 ± 0.05
4.2
Cys
9.90 ± 0.06
9.48 ± 0.02
9.63 ± 0.07
10.30 ± 0.03
10.06 ± 0.06
9.54 ± 0.01
4.0
Asn
9.90 ± 0.5
9.43 ± 0.03
9.80 ± 0.00
9.85 ± 0.02
10.00 ± 0.05
10.28 ± 0.03
3.8
Met
10.98 ± 0.00
11.03 ± 0.03
11.08 ± 0.04
11.13 ± 0.02
11.22 ± 0.03
11.32 ± 0.04
3.1
Try
10.23 ± 0.03
9.83 ± 0.08
10.13 ± 0.03
10.25 ± 0.02
10.53 ± 0.03
10.30 ± 0.01
2.9
Gly
10.38 ± 0.00
9.98 ± 0.05
10.14 ± 0.02
10.47 ± 0.08
10.54 ± 0.08
10.63 ± 0.02
2.4
Pro
10.23 ± 0.03
9.93 ± 0.03
8.08 ± 0.08
8.58 ± 0.03
9.05 ± 0.05
8.98 ± 0.08
−2.9
Phe
10.23 ± 0.03
9.65 ± 0.02
8.80 ± 0.00
8.90 ± 0.01
9.15 ± 0.00
9.03 ± 0.03
−5.7
Effects of amino acids addition on glutathione biosynthesis of selenium-enriched yeast.
Amino acid (mmol L−1)
Glutathione (mg L−1)
Maximum ratio increased (%)
0
2
4
6
8
10
Cys
66.2 ± 1.6
74.8 ± 0.4
79.5 ± 2.6
92.8 ± 0.3
109.2 ± 2.2
134.2 ± 1.7
102.7
Ala
73.1 ± 2.5
94.8 ± 1.7
130.4 ± 2.5
68.8 ± 0.6
78.9 ± 1.2
63.8 ± 2.1
78.4
Asp
73.1 ± 2.5
47.6 ± 0.6
97.6 ± 1.6
121.1 ± 2.1
58.7 ± 0.8
75.7 ± 1.2
65.7
Glu
82.0 ± 0.7
69.7 ± 0.5
90.1 ± 0.0
105.8 ± 0.3
110.6 ± 4.7
127.2 ± 0.4
55.1
Gln
71.4 ± 1.2
72.6 ± 1.6
71.0 ± 2.4
81.3 ± 0.2
93.5 ± 1.1
106.9 ± 1.3
49.7
Leu
77.0 ± 1.1
73.2 ± 1.2
93.7 ± 0.5
98.8 ± 0.6
109.8 ± 1.7
115.1 ± 2.5
49.5
Met
87.5 ± 1.5
94.5 ± 2.2
101.4 ± 1.6
108.4 ± 1.2
118.6 ± 2.6
130.7 ± 3.4
49.4
Tyr
62.1 ± 1.8
60.9 ± 0.1
73.8 ± 0.3
82.2 ± 0.0
82.5 ± 4.9
91.9 ± 1.4
48.0
Arg
62.1 ± 1.8
70.4 ± 2.6
66.4 ± 2.0
77.0 ± 2.1
86.0 ± 1.6
77.9 ± 2.3
38.5
Ile
77.0 ± 1.1
80.6 ± 1.0
88.1 ± 2.0
93.7 ± 0.3
102.4 ± 1.0
101.3 ± 2.1
33.0
Val
61.4 ± 0.7
69.9 ± 0.4
71.1 ± 1.2
71.3 ± 2.1
76.2 ± 0.6
79.6 ± 2.6
29.6
Try
88.1 ± 1.9
91.3 ± 0.6
95.6 ± 0.3
96.2 ± 4.5
105.0 ± 1.0
111.0 ± 2.7
26.0
His
66.2 ± 1.6
72.7 ± 1.7
76.9 ± 0.3
80.7 ± 2.4
83.2 ± 2.3
82.6 ± 1.2
25.7
Thr
73.5 ± 4.6
82.2 ± 2.6
77.9 ± 2.4
78.7 ± 0.8
84.7 ± 2.2
85.6 ± 3.2
16.5
Ser
73.1 ± 2.5
57.2 ± 1.7
67.6 ± 0.4
74.6 ± 0.4
84.0 ± 0.4
81.0 ± 2.4
14.9
Gly
82.0 ± 0.7
64.5 ± 0.9
70.1 ± 0.4
77.2 ± 1.7
92.5 ± 2.5
90.5 ± 1.3
12.8
Asn
71.4 ± 1.2
63.6 ± 1.1
69.7 ± 0.5
68.3 ± 0.9
71.6 ± 1.8
75.0 ± 2.2
4.7
Phe
88.1 ± 1.9
80.6 ± 2.5
75.0 ± 3.7
78.4 ± 0.3
82.2 ± 2.0
85.2 ± 0.3
−3.3
Lys
78.0 ± 0.8
66.4 ± 1.8
69.7 ± 0.7
67.3 ± 1.4
64.1 ± 0.4
66.8 ± 0.0
−10.6
Pro
78.0 ± 0.8
45.5 ± 1.8
29.7 ± 3.0
21.8 ± 0.9
31.8 ± 1.1
36.2 ± 0.7
−41.7
The ratio of extracellular glutathione decreased with amino acids addition.
Amino acid (mmol L−1)
The ratio of extracellular glutathione (%)
Maximum ratio decreased (%)
0
2
4
6
8
10
Cys
80.6 ± 0.3
28.6 ± 0.5
28.8 ± 0.4
28.0 ± 0.3
29.2 ± 0.1
30.9 ± 0.2
65.3
Glu
83.3 ± 0.2
84.6 ± 0.5
61.0 ± 0.0
47.7 ± 0.4
36.0 ± 0.3
31.6 ± 0.1
62.1
Leu
89.1 ± 0.1
82.2 ± 0.3
45.4 ± 0.2
41.9 ± 0.5
36.8 ± 0.4
30.3 ± 0.2
66.0
Ile
89.1 ± 0.1
72.5 ± 0.3
54.1 ± 0.5
41.4 ± 0.2
36.2 ± 0.1
36.8 ± 0.4
59.4
Tyr
80.9 ± 0.4
79.8 ± 0.4
54.3 ± 0.2
35.8 ± 0.1
35.4 ± 0.2
35.3 ± 0.4
56.4
Asp
78.0 ± 0.4
74.1 ± 0.1
41.6 ± 0.3
39.7 ± 0.4
81.9 ± 0.5
82.6 ± 0.3
49.1
Gln
83.9 ± 0.5
80.6 ± 0.3
83.8 ± 0.4
74.3 ± 0.2
68.1 ± 0.1
45.0 ± 0.1
46.4
Thr
79.8 ± 0.4
73.6 ± 0.3
82.0 ± 0.1
81.6 ± 0.3
48.3 ± 0.5
45.9 ± 0.1
42.5
Arg
80.9 ± 0.4
63.5 ± 0.3
76.8 ± 0.4
47.0 ± 0.5
48.5 ± 0.4
62.5 ± 0.3
41.9
Phe
73.0 ± 0.4
67.6 ± 0.3
53.0 ± 0.3
46.8 ± 0.3
45.9 ± 0.5
42.9 ± 0.3
41.2
Met
71.1 ± 0.1
65.8 ± 0.4
61.2 ± 0.1
57.2 ± 0.1
50.0 ± 0.3
42.4 ± 0.2
40.4
Try
73.0 ± 0.4
67.6 ± 0.4
59.9 ± 0.4
54.6 ± 0.3
54.4 ± 0.1
45.2 ± 0.3
38.1
Val
89.4 ± 0.2
85.2 ± 0.4
84.7 ± 0.4
84.7 ± 0.2
82.8 ± 0.4
56.6 ± 0.3
36.7
Ala
78.0 ± 0.4
56.8 ± 0.4
52.4 ± 0.2
67.4 ± 0.2
69.5 ± 0.3
72.8 ± 0.4
32.8
Pro
83.3 ± 0.2
70.2 ± 0.1
67.5 ± 0.3
60.3 ± 0.4
66.2 ± 0.5
67.4 ± 0.2
27.6
Gly
83.3 ± 0.2
94.7 ± 0.3
89.6 ± 0.5
77.8 ± 0.4
65.7 ± 0.4
62.6 ± 0.3
24.8
His
80.6 ± 0.3
71.2 ± 0.1
69.3 ± 0.2
63.7 ± 0.4
63.4 ± 0.2
63.6 ± 0.3
21.3
Ser
78.0 ± 0.4
82.9 ± 0.5
70.6 ± 0.4
66.0 ± 0.6
64.3 ± 0.2
64.5 ± 0.2
17.6
Asn
83.9 ± 0.5
82.6 ± 0.1
83.5 ± 0.4
84.4 ± 0.2
83.9 ± 0.3
85.2 ± 0.2
1.5
Lys
83.3 ± 0.2
96.2 ± 0.1
96.4 ± 0.2
96.5 ± 0.1
96.3 ± 0.3
89.5 ± 0.3
−7.4
oai:pubmedcentral.nih.gov:30394762011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30394762135065710.4061/2011/141649Research ArticlePCR-Based Identification and Characterization of Fusarium sp. Associated with Mango MalformationArifM.1, 2*PaniD. R.2ZaidiN. W.1SinghU. S.11Department of Plant Pathology, G. B. Pant University of Agriculture and Technology, Pantnagar (U. S. Nagar), Uttarakhand 263145, India2Department of Molecular Biology & Genetic Engineering, G. B. Pant University of Agriculture and Technology, Pantnagar (U. S. Nagar), Uttarakhand 263145, India*M. Arif: marif181@gmail.com
Mango malformation is the most serious disease of mango causing considerable damage to the mango orchards worldwide. It is a major threat for mango cultivation in north Indian belt. In recent years, Fusarium sp. is finding wide acceptability in scientific community as a causal agent of this disease. However, little information is known about the variability in Fusarium isolates from malformed mango tissues. Therefore, the major objective of present study was the identification and analysis of genetic diversity among Fusarium isolates collected from malformed mango tissues. Two texon selective primers, ITS-Fu-f and ITS-Fu-r, were used for quick identification of Fusarium spp. The fungal genomic DNA was extracted from using CTAB method and was utilized as template for PCR amplification. Total 224 bands were amplified by 18 RAPD primers at an average of 12.44 bands per primer. The size of the obtained amplicons ranged from 0.264 kb (minimum) to 3.624 kb (maximum). Data scored from 25 isolates of Fusarium sp. with 18 RAPD primers were used to generate similarity coefficients. The similarity coefficient ranged from 0.17 to 0.945. Based on DNA fingerprints, all isolates were categorized into two major clusters. This study indicated a wide variability among different isolates of Fusarium.
1. Introduction
Malformation, arguably the most important disease of mango (Mangifera indica L.) globally, is of growing concern not only because of its widespread and destructive nature but also because its etiology and control are not well understood. Mango malformation was reported for the first time by an expert mango grower from Darbhanga district in Bihar in 1891 [1]. Malformation is not only well known in India but has also been confirmed in most mango growing countries like Pakistan, Egypt, South Africa, Brazil, Israel, Central America, Mexico, and USA [2]. There is a lot of confusion in the literature about the etiology of this malady because research efforts made hitherto have not been able to ascertain its etiology. The complexity of the disorder is attributed by many factors like mites, fungal, viral, and physiological factors. However, in recent years, Fusarium spp. are finding wide acceptability in scientific community as a causal agent of this disease.
All the disease management strategies based on host resistance require the knowledge of variability in pathogens, that is why the objective of this study was to develop a polymerase chain reaction (PCR) assay to examine genetic variation in a larger collection of the pathogen. Also, DNA-based genetic markers provide a genetic diagnostic tool that permits direct identification of pathotypes in any developmental stage in environment-independent manner [3]. The two texon selective primers, ITS-Fu-f and ITS-Fu-r, were used for quick identification of Fusarium spp. [4]. Arbitrary 18 primers were used in RAPD to produce characteristic profiles of amplified products.
2. Material and Method2.1. Isolates of Fusarium spp
Twenty-five samples of malformed panicles and seedlings were collected from various orchards from different locations at Pantnagar. Infected samples were cut into small pieces and surface sterilized with 0.2% sodium hypochlorite solution for 2 minutes. Thereafter, the samples were washed with sterilized distilled water before placing them in Petriplates containing Potato Dextrose Agar (PDA) medium. The sealed plates were kept in a BOD incubator at 28°C ± 2°C for 4 days until the fungus growth appeared. Fresh fungal growth from the plated samples was then transferred on PDA. Finally, every isolate was further purified by single-spore culture on PDA. potato dextrose broth (PDB) medium was used for the harvesting of mycelium for DNA extraction.
3. DNA Extraction
Fungal genomic DNA was extracted for molecular characterization studies. Total DNA was extracted by using the CTAB (Hexa-decyl tri-methyl ammonium bromide) method of [5]. For the extraction of DNA, 1 g of freshly harvested mycelium was ground in liquid nitrogen with a mortar pestle into a very fine powder. Powder was suspended in 10 ml of DNA extraction buffer (50 mM Tris Buffer pH 8.0, 100 mM EDTA, 150 mM NaCl). After proper shaking, 1 ml of 10% SDS was added and incubated for 1 h at 37°C. 1.5 ml of 5 M NaCl and 1.25 ml of CTAB solution (10% CTAB and 0.7 M NaCl) were added and incubated at 65°C for 20 minutes in an incubator shaker at 60 rev. per minute. DNA was extracted by adding an equal volume of Chloroform: Isoamyl Alcohol (24 : 1 V/V) and mixed thoroughly but gently and then centrifuged at 10000 rpm for 12 min at 10°C. Aqueous viscous supernatant was removed to a fresh tube and precipitated with 0.6 volumes of ice-cold isopropanol and 0.1 volume sodium acetate and left overnight in the freezer at −20°C. The mixture was centrifuged at 10000 rpm for 10 min at 10°C. Pellet was washed with 70% ethanol, dried completely, and dissolved in minimum amount of TE buffer. DNA was purified by RNAse treatment and quantified by UV Spectrophotometer.
4. Primers, PCR Amplification, and Gel Electrophoresis
PCR amplification with arbitrary primers for RAPD was carried out in 25 μl reaction containing 2 μl dNTP (250 μM each dNTP), 1 μl primer (20 ng/μl), 1 μl template DNA (30 ng/μl), 2.5 μl reaction buffer (10X), 0.5 μl Taq DNA polymerase (3 U/μl), and deionized water 18.0 μl. PCR amplification for ribosomal DNA regions was carried out in 50 μl reaction containing 2 μl dNTP (250 μM each dNTP), 1 μl primer reverse and forward (20 ng/μl each), 1 μl template DNA (30 ng/μl), 2.5 μl reaction buffer (10X), 2.5 U Taq DNA polymerase, and remaining deionized water. PCR reactions were performed with PTC-200 peltier thermal cycler (MJ research inc., Watertown, MS, USA) for both ribosomal amplification with 30 cycles (1 min denaturing at 94°C, 30 sec annealing at 54°C, and 1 min polymerization at 72°C) and RAPD with 35 cycles (1 min denaturing at 94°C, 1 min annealing at 44°C, and 2 min polymerization at 72°C).
After completion of amplifications, 3 μl of gel loading dye was added to each sample, and 25 μl total volumes were resolved on 1.8% (Ribosomal amplified) and 1.5% (RAPD) agarose gel in 0.5X TBE buffer. The size of amplified DNA fragments was estimated with 100 bp ladders (Bangalore Genei Pvt. Ltd., India). Detail of arbitrary primers, synthesized from SIGMA (Sigma-Aldrich, St. Louis, USA), is given in Table 1.
5. Data Analysis
DNA fingerprints were scored for the presence (1) or absence (0) of bands of various molecular weight sizes in the form of binary matrix. Data were analyzed to obtain Jaccard's coefficients among the isolates by using NTSYS-pc (version 2.11V; Exeter Biological Software, Setauket, NY). Jaccard's coefficients were clustered to generate dendrograms by using the SHAN clustering programme, selecting the unweighted pair-group method with arithmetic average (UPGMA) algorithm version 2.11v in NTSYS-PC computer package (Exter software, NY; [6]).
6. Results and Discussion
The present work deals with molecular characterization of Fusarium sp. isolated from malformed mango tissues. The molecular studies were carried out with the optimization or standardization of DNA extraction procedures from mycelium of the fungus, and evaluation of polymerase chain reaction to explore the variability among different isolates of Fusarium sp. has emerged as most likely cause of malformation disease in mango ([2]; Freeman et al.; U. S. Singh, personnel communication). However, little information is available on variability in Fusarium sp. isolated from malformed mango tissues. Knowledge of genetic mechanisms underlying the variability in pathogen (Fusarium sp.) is almost invariably achieved through the use of molecular markers, that is, molecules which serve to distinguish one species or isolate it from another.
The dominant marker RAPD was used to calculate the genetic distance between 25 Fusarium isolates using Jaccard's similarity coefficient which takes into account the presence or absence of bands.
All twenty-five isolates of Fusarium sp. were isolated from malformed panicles and bunchy top seedlings of mango. They were purified by single-spore isolation and subjected to identification by using two Fusarium selective primers which gives approximately 410 bp band (Figure 1). These isolates were compared and categorized at molecular level by using a powerful and extremely sensitive technique RAPD-PCR. The conditions for PCR amplification of fungal DNA were optimized for determining the template DNA concentration and primer suitability. Thirty primers were used to characterize the genetic diversity present among 25 isolates. Eighteen of these primers showed a total of 224 reproducible bands with 12.44 bands per primer. Each of the primers varied greatly in their ability to resolve variability among the genotypes. All primers were able to give high polymorphism among the isolates (Figure 2). The size of the obtained amplicons ranged from 0.264 kb (minimum) to 3.624 (maximum) while the similarity coefficient ranged from 0.17 to 0.94.5 (Table 2).
Association among 18 genotypes revealed by unweighted pair-group methods with Arithmetic mean (UPGMA) cluster analysis was presented in Figure 3.
A total of 18 primers having GC content ranging from 33.3 to 70% were used in the study. The UPGMA cluster analysis clearly grouped these isolates into two major clusters and established their relationship of similarity. The cluster analysis comprising the 25 isolates showed 17.4% (isolates 18 and 14) to 94.5% similarity in RAPD analysis. Cluster I has 20 isolates F1, F2, F3, F4, F5, F6, F7, F8, F9, F10, F11, F12, F13, F14, F15, F17, F20, F21, F23, and F24 and Cluster II has 5 isolates F16, F18, F19, F22, and F25. A relatively high level of variability (17.4 to 94.5%) was recorded among different isolates of Fusarium sp. Similarly Zheng and Ploetz [7] recorded wide variation in RAPD profiles of 74 isolates of Fusarium from mango using 10-mer primers. Further studies are needed to confirm this fact by morphological studies. A number of Fusarium spp. have already been isolated from malformed mango tissues [1]. However, F. subglutinans (Wollenw. and Reink) P. E. Nelson, T. A. Toussoun & Marasas (= F. moniliforme var. subglutinans, Wollenw. and Reink) is reported to be most commonly associated species with both floral and vegetative malformation. However, taxonomy and nomenclature of this species have recently been in flux [7]. Based on molecular characterization of 95 isolates of Fusarium sp. from malformed mango tissues, it can be concluded that all mango isolates belong to a new species of Fusarium. The pattern of cluster analysis is further confirmed by principal component analysis (Figure 4). The numbers plotted represent individual isolates of Fusarium spp.
The Matrix correlation (r) value of this marker is 0.93842, indicating very good fit between distance or similarity matrix and dendogram obtained. The results for RAPD marker are presented in two- and three-dimensional score plots (Figure 4). In this case, the cluster as well as the score plots of principal component analysis was found similar. The result of pairwise combinations indicated highest similarity (coefficient 0.945) between isolates 9 and 10. Isolates 4 and 6 also exhibited high degree of similarity (92.4%). The use of single or combination of two or more primers differentiated most of the genotypes. By using the 18 primers, all the genotypes could be distinguished from each other. So this study is helpful to understand the actual cause as well as the causal organism of the disease and can further support and strengthen the fact that Fusarium sp. is the actual causal organism of this disease.
KumarJBeniwalSPSRole of Fusarium species in the etiology of mango malformationIn: Proceedings of the the 4th International Mango SymposiumJuly 1992Miami, Fla, USA133KumarJSinghUSBeniwalSPSMango malformation: one hundred years of researchAnnual Review of Phytopathology199331217232PowellWMorganteMAndreCThe comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysisMolecular Breeding199623225238Abd-ElsalamKAAlyINAbdel-SatarMAKhalilMSVerreetJAPCR identification of Fusarium genus based on nuclear ribosomal-DNA sequence dataAfrican Journal of Biotechnology20032496103LeeSBTaylorJWInnisMAGelfandDHSninskyJJWhiteTJIsolation of DNA from fungal mycelia and single sporesThe PCR Protocols: A Guide to Methods and Applications1990New York, NY, USAAcademic Press282314RohlfFJNT-SYS-pc: Numerical Taxonomy and Multivariate Analysis System. Version 2.11V1993Setauket, NY, USAExteer SoftwareZhengQPloetzRGenetic diversity in the mango malformation pathogen and development of a PCR assayPlant Pathology2002512208216
Amplification of 410 bp amplicon using Fusarium-specific primers.
Amplification profile of 25 isolates of Fusarium spp. obtained using PP1 primer.
Combined phenogram of 25 isolates of Fusarium species using 18 primers constructed by NTsys PC.
Three-dimensional view of score plot resulted from principle coordinate analysis of RAPD data.
Primers and their codes used for PCR amplification of 25 isolates of Fusarium spp.
Primers code used in present study
Primers sequence
GC (%)
PP1
5′ ACC GCG AAG G 3′
70
PP2
5′ GGA CCC AAC C 3′
70
PP3
5′ GTC GCC GTC A 3′
70
PP4
5′ GTC TGC CCC A 3′
70
PP5
5′ AGA TGC AGC C 3′
60
PP6
5′ GTT TCG CTC C 3′
60
PP7
5′ GTG AGG CGT C 3′
70
PP8
5′ GTG ACA TGC C 3′
60
PP9
5′ ACTCAGCCAC 3′
60
PP10
5′ CGTAGTGGTG 3′
60
PP11
5′ CGGTTTGGTC 3′
60
PP12
5′ GGACGATTCG 3′
60
PP13
5′ GGGGGTTAGG 3′
70
PP14
5′ GAGGAGGAGGAGGAG 3′
66.6
PP15
5′ CATCATCATCATCAT 3′
33.3
PP16
5′ TCTGGTGACC 3′
60
PP17
5′ CCGCATCCTA 3′
60
PP18
5′ CAGGCCCTTC 3′
70
Similarity matrix of 25 isolates of Fusarium sp. isolated from mango malformed tissues of mango.
F1
F2
F3
F4
F5
F6
F7
F8
F9
F10
F11
F12
F13
F14
F15
F16
F17
F18
F19
F20
F21
F22
F23
F24
F25
F1
1.000
F2
0.664
1.000
F3
0.629
0.868
1.000
F4
0.664
0.872
0.895
1.000
F5
0.452
0.500
0.525
0.547
1.000
F6
0.635
0.835
0.842
0.924
0.546
1.000
F7
0.600
0.712
0.744
0.211
0.525
0.831
1.000
F8
0.606
0.798
0.805
0.839
0.521
0.863
0.869
1.000
F9
0.400
0.446
0.439
0.460
0.346
0.451
0.413
0.429
1.000
F10
0.396
0.442
0.435
0.446
0.325
0.447
0.400
0.426
0.945
1.000
F11
0.547
0.639
0.657
0.676
0.510
0.698
0.664
0.669
0.448
0.454
1.000
F12
0.563
0.676
0.669
0.737
0.547
0.746
0.750
0.716
0.404
0.391
0.704
1.000
F13
0.353
0.371
0.365
0.402
0.562
0.421
0.411
0.392
0.371
0.350
0.455
0.472
1.000
F14
0.314
0.278
0.280
0.326
0.443
0.338
0.356
0.326
0.259
0.244
0.316
0.369
0.526
1.000
F15
0.557
0.696
0.652
0.733
0.510
0.768
0.695
0.737
0.449
0.437
0.608
0.710
0.421
0.360
1.000
F16
0.303
0.351
0.354
0.357
0.289
0.359
0.331
0.339
0.351
0.329
0.366
0.377
0.342
0.228
0.352
1.000
F17
0.431
0.459
0.485
0.507
0.440
0.507
0.542
0.515
0.340
0.335
0.503
0.532
0.340
0.307
0.472
0.289
1.000
F18
0.254
0.234
0.227
0.226
0.206
0.230
0.227
0.229
0.278
0.255
0.253
0.269
0.228
0.174
0.243
0.386
0.265
1.000
F19
0.230
0.221
0.223
0.214
0.227
0.210
0.206
0.209
0.291
0.268
0.273
0.264
0.240
0.200
0.247
0.388
0.231
0.815
1.000
F20
0.368
0.450
0.453
0.454
0.378
0.464
0.427
0.481
0.386
0.382
0.490
0.460
0.403
0.259
0.472
0.348
0.464
0.268
0.263
1.000
F21
0.343
0.415
0.439
0.431
0.375
0.411
0.371
0.418
0.335
0.340
0.398
0.400
0.335
0.256
0.383
0.383
0.349
0.238
0.242
0.507
1.000
F22
0.381
0.381
0.412
0.405
0.363
0.388
0.396
0.413
0.327
0.322
0.395
0.405
0.327
0.262
0.371
0.400
0.338
0.323
0.305
0.368
0.353
1.000
F23
0.369
0.406
0.438
0.430
0.371
0.431
0.393
0.428
0.388
0.384
0.486
0.437
0.378
0.284
0.439
0.349
0.376
0.275
0.306
0.510
0.480
0.333
1.000
F24
0.343
0.336
0.347
0.369
0.384
0.372
0.389
0.369
0.283
0.278
0.378
0.408
0.392
0.324
0.373
0.321
0.369
0.240
0.244
0.351
0.344
0.363
0.422
1.000
F25
0.315
0.292
0.311
0.308
0.317
0.310
0.299
0.308
0.301
0.305
0.316
0.346
0.301
0.220
0.305
0.391
0.291
0.389
0.403
0.316
0.375
0.392
0.420
0.323
1.000
oai:pubmedcentral.nih.gov:30426022011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30426022135066210.4061/2011/572521Research ArticleAssessing Market-Sold Remedies in Lomé (Togo) for Hygienic Qualityde SouzaComlanAmeyapohYaoviKarouSimplice D.*AnaniKokou T.KpodarMadje L.GbeassorMensaviCentre de Recherche et de Formation sur les Plantes Médicinales (CEFOPLAM), ESTBA, Université de Lomé, Lomé BP 1515, Togo*Simplice D. Karou: simplicekarou@hotmail.com
Traditional concoctions sold in marketplaces are always assumed to be safe and efficient; however, they can be potentially toxic because of poor hygienic practices in plant processing or storage. The present study aimed to assess for the microbial quality of market-sold vegetable drugs in Lomé. Thus, a total of 209 plant remedies were collected in marketplaces and analysed for the presence of total aerobic bacteria, total coliforms, thermotolerant coliforms, Staphylococcus aureus, sulphite reducing bacteria, and yeast and moulds according to the French Association of Normalisation (AFNOR) guidelines. The results revealed that all formulations were contaminated by several microorganisms, excepted alcohol-based mixtures. According to AFNOR limits nonconform drugs were according to total aerobic bacteria (86.96% powders, 81.82% capsules, 66.67% tisanes, and 42.11% decoctions); to total coliforms (9.10% capsules, 8.70% powders and 1.75% decoction); to yeasts and moulds (77.78% ointments, 40% calcined powders, 36.36% capsules, and 23.91% powders). The microbiological analysis revealed that the majority of contaminating bacteria were gram positive catalase positive and oxidase positive bacilli. Quality control studies on market-sold remedies are currently needed to evaluate the microbial risk in consuming these products and they may allow the standardisation of plant processing and storage.
1. Introduction
Plants have formed the basis of traditional medicine (TM) that was used thousands years ago by humans. Until today plant-based medicine continues to play a key role in health-care systems in many regions worldwide, principally in Africa where modern drugs are not affordable. Indeed, it has been estimated to 80% the percentage of people who only rely on TM for their primarily health care in Africa [1, 2]. Following leads supplied with traditional healers (TH), many plants have been screened in laboratories for biological activities. The majority of these studies conducted in vitro or on animal models often showed scientific rational behind plant usage with sometimes isolation of single pure compounds as active principle [3–5]. However, theses studies are focussed on plant extracts prepared by scientists after collecting plant materials them self. The extractions are made with organic solvents such as chloroform, methanol, or ethanol; sometimes they make decoctions in accordance with traditional practices [6–9]. Very few works have been conducted on vegetable drugs directly provided by TH, since the manufacturing of labelled and packaged herbal concoctions with claims to cure diseases is still new in Africa. The recipes and preparations are of TM origin while the packaging and presentations are western; of course they still lack western safety and quality controls [10, 11].
Working on these drugs must be a new challenge for many reasons. Using plants for medicinal purposes is a question of tradition and culture in Africa; thus collecting, processing, and applying plants or plant-based medication has been handed down from generation to generation. Traditional medicines with medicinal plants as their most important components are sold in market places or prescribed by TH in their homes [12, 13]. The physical conditions and infrastructure in these markets are generally poor, with most plant material displayed in the open. Under these conditions, the material is exposed to microbial and insect attack as well as the effects of light, gases, and temperature. Often, these informal markets are situated close to both pedestrian and motor vehicle traffic, which places plant material in contact with various kinds of pollution [14]. The main problem with these drugs is their hygienic quality in three key regards: healers often collect plant material around or in bushes near habitations and prepare drugs without any preliminary treatment to eliminate indigenous microbes sometimes, plant processing is carried out in their homes in nonadequate hygienic conditions, and prepared drugs are stored in inappropriate conditions. Overall, the final product proposed to the patients is sometimes of poor hygienic quality [15].
The purpose of the present study was then to access for the microbial quality of vegetable drugs sold in marketplaces in Lomé town (Togo).
2. Material and Methods2.1. Samples Collection
Drug samples analysed in the present study were collected from vegetable drug's sellers in marketplaces in Lomé town or around Lomé (Togo) from March to June 2006. Afterwards, enquiries were made with available drugs providers by oral questioning to access for plant processing in particular plant materials collections, diagram of drug preparations, and therapeutic indication of drugs if not available on the packages.
2.2. Cell Enumeration
All media used in this study were purchased from BioRad (France). For each sample, 10 g (for solid sample) or 10 mL (for liquid sample) were mixed with 90 mL trypton-salt water (0.85% w/v) and stored at ambient temperature for 45 min. Afterwards, tenfold serial dilutions were made for each suspension and 1mL diluted suspension was used to inoculate specific culture media for microbial isolation and enumeration as recommended by the French Association of Normalisation [16]. The total number of microorganisms expressed as Colony Forming Unit (cfu) per gram or per mL of sample was determined by standard plate count. The following microorganisms were enumerated under the following conditions.
Total aerobic bacteria with Plate Count Agar (PCA) after 24 hours incubation at 30°C.
Total coliforms and thermotolerant coliforms on Violet Red Bile Lactose (VRBL) after 24 hours incubation at 30 and 44°C, respectively.
Staphylococcus aureus by counting chapman coagulase positive colonies after 24 hours incubation at 37°C.
Sulphite Reducing Bacteria (SRB) by Most Probably Number (MPN) with tryptone-sulfite neomycin broth after 20 hours incubation at 44°C.
Yeast and moulds with Sabouraud-Cloranfenicol after 3 to 5 days incubation at 30°C.
Microbial quality of drugs was assayed using the critical limits of French Association of Normalisation (AFNOR). Catalase test was performed by adding hydrogen peroxide on a single colony. The presence of catalase was revealed by the formation of gas bubbles. Oxidase tests were performed using available commercial oxidase disks purchased from Bio Rad (France).
3. Results3.1. Formulations and Therapeutic Indications
A total of 209 products were collected in marketplaces in Lomé town and in markets around the town. The drugs were presented in several formulations including decoctions, powders, capsules, ointments, soaps, alcohol-based mixtures (ABM), honey-based mixtures (HBM), calcined powders, and tisanes. Overall, decoctions formulations were most represented followed by powders and ointments (Table 1). Drugs were packed in bottles or in plastic sachets. Original packages with printed therapeutic indications and expiration dates accounted for 15% (31/209) of drugs. The others (85%) were in recovered packages with therapeutic indications or without any information. In this case, therapeutic indications were orally provided by the seller. Another concern with theses remedies was that, the ingredients and their relative quantities were not listed on the product label. This was always kept as a secret for the TH.
Drugs were assumed to cure many diseases as indicated in Table 2. According to the table, microbial infections, sexual weakness, dermatitis, hypertension, and malaria were the most cited.
3.2. Plant Materials Processing
Enquiries with drug providers allowed accessing for the general procedure in drug preparation (Figure 1). Globally, plants materials were collected around habitations or in bushes and the healers only relied on their own experience in plant identification. Collected samples were processed in 5 steps including the cleaning and the washing, the cutting of the plant materials into small slices and the drying of the slices. Afterwards the treatment may differ according to the TH and the formulation of the product. The dried slices could be directly used as tisane, but for the other formulations the dried slices were ground in a mortar prior further processing.
Powders and capsules: the ground plant materials are mixed with other substances of mineral or animal origin and the mixture can then be manually or semimanually packed in capsules or directly packed in bottles or in sachet and ready for use.
Calcined powders: the slices are calcined in a pot until darkness. The calcine is cooled with water and ground in a mortar. For use, many of theses powders are often dissolved in “sodabi,” local liquor distilled from palm wine.
Honey-based mixture: this is prepared by adding the vegetable powder directly on the honey.
Soaps are prepared with vegetable or animal oil. The oil is boiled with vegetable powder until complete homogenisation of the mixture. The mixture is then filtered and mixed with sodium hydroxide or potassium hydroxide and boiled before cooling at room temperature in their packages.
Ointments: the ground plant materials are mixed with melted shea butter or Vaseline colorant or essential oil can be added to the mixture and the product can be distributed in packages or stored.
Decoctions: the dried slices from single plant or plant mixture are boiled together with other products of animal origin or minerals. The boiling may take 1 to 12 hours according to TH or to products. After cooling in air to ambient temperature the product is packed in bottles or stored in drums.
ABM: local liquor distilled from palm wine and often called “sodadi” is added to the dried slices in bottles the mixture is allowed to stay for 15 to 30 days before use.
Microbial quality was assayed for all the 209 collected drugs. The following microorganisms were enumerated: total aerobic bacteria, total coliforms and thermotolerant coliforms, S. aureus, SRB, yeast, and moulds. According to our results, neither S. aureus nor BSR were found in the analysed products. For the other microorganisms, excepted AMB, all the formulations were contaminated. The drugs were much contaminated by total aerobic microorganisms. Gram staining, catalase, and oxidase tests made on these microorganisms revealed that they were essentially gram positive, catalase positive, and oxidase bacilli. Total coliforms were found to occur in decoctions, powders, and capsules. Moulds and yeasts occurred in all formulations excepted tisanes and ABM. In accordance with the ARNOR limits, only ABM was conform according to all enumerated microorganisms. The conformity of the other drugs varied according to microorganisms. Figure 2 displays the percentages of nonconform drugs as a function of microorganisms. The majority of nonconform drugs were according to total aerobic bacteria: 86.96% powders, 81.82% capsules, 66.67% tisanes, and 42.11% decoctions. Yeast and moulds were the second agent of nonconformity of the products indeed, 40% calcined powders, 36.36% capsules, and 23.91% powders were not conform according to these germs.
4. Discussion
The present study aimed to assess for the microbial quality of several vegetable drugs sold in Lomé town in order to evaluate the microbial risk in consuming these products. As many other countries in Africa, Togolese government recognises the importance of TM as a key provider of primary health-care and is promoting the integration of traditional healing into the official health care system. However, treatment with traditional remedies may expose the patients to three major risks: the inefficacy of the remedy to cure the disease, the poisoning by toxic compound occurring in plant materials, and the poisoning by microbial toxins, or microorganisms occurring in poor hygienic quality remedies [17]. Nowadays, much effort is being made by scientists in solving the two first problems through biological screenings of plant extracts for biological activities in vitro or on animal models [18, 19]. The main problem remains the poisoning by contaminating microorganisms or their toxins in plant products.
Contamination by microbial pathogen may occur in plant processing or during the storage [15]. The results of the present study revealed that the traditional remedies sold in Lomé marketplaces are contaminated by microbial pathogens; however, S. aureus and SRB were not detected in the drugs. The interest in detecting these two microorganisms is that S. aureus is the leading species of the genus Staphylococcus implicated in food poisoning infection. SRB are a group anaerobic sporulating bacteria including Clostridium, their spores resist after heat treatment and may cause damages after contaminated product consumption. Excepted ABM, contamination by total aerobic bacteria occurred for all formulations including decoctions which were also contaminated by total coliforms indicating faecal origin contamination. Since decoctions passed by a boiling step, their contamination occurred after the processing. In fact, some TH often prepare their drug in poor environmental conditions and store their drugs in nonsterile bottles as we remarked in our enquiries. Of course powders which do not pass by a heating step are more contaminated. Elimination of yeasts and mould from foods and other products remains difficult because they produce thermoresistant spore that survive heat treatment. Indeed our results indicated that all formulations were contaminated by yeast and mould excepted ABM and tisanes. The main risk with theses microorganisms is the fact that some strains can elaborate mycotoxins occasioning poisoning.
Despite microbial contamination of market-sold traditional remedies, expiration dates could also be pointed out. In our enquiries many healers did not mention expiration date of their products. The ones who provided it only relied on empirical observations. It is evident that the biological activity of plant extract is time-dependent, phenolic compounds are the main examples. They are vulnerable to polymerization through air oxidization. High polymerization results in insoluble complex that precipitate in solution. This oxidization may first affect the extractability of the phenolic compounds that is crucial in drug preparation; in this topic some authors suggested extracting the compounds directly on fresh material in order to enhance the yield [20]. Secondly, an important factor governing the activity of phenolic compounds is their polymerization size. Oxidized condensation of phenols may result in the toxification of microorganisms, while the adverse effects can be observed in some cases [21–23]. Storage and drying process may then affect the chemical composition of the material. It is useful to use fresh material rather than dried material but this is the form which is usually preferred by traditional healers [24]. In accordance with these observations relying only on empirical observations to estimate expiration date is not the adequate way. In addition, TH rely on empirical experience in the plant identification, there also remains a major risk of misidentification.
The lack of quality control and regulations on standardisation of natural products may result in varying concentrations of active compounds, consumption of contaminants such as microbes or their microbial toxins, heavy metals, and possible fatal side effects as a result of misidentification of plant material. In addition, convincing TH to reveal their ingredients as well as the recipes of their products as it is a guarded secret amongst them still remains a challenge.
Acknowledgment
The authors gratefully thank the traditional healers who accepted to answer to their questions.
HostettmannKMarstonATwenty years of research into medicinal plants: results and perspectivesPhytochemistry Reviews200213275285WHOTraditional medicine2009, http://www.who.int/topics/traditional_medicine/enGómez CastellanosJRPrietoJMHeinrichMRed Lapacho (Tabebuia impetiginosa)—a global ethnopharmacological commodity?Journal of Ethnopharmacology2009121111318992801KarouDDickoMHSanonSSimporeJTraoreASAntimalarial activity of Sida acuta Burm. f. (Malvaceae) and Pterocarpus erinaceus Poir. (Fabaceae)Journal of Ethnopharmacology2003892-329129414611894KarouDSavadogoACaniniAAntibacterial activity of alkaloids from Sida acutaAfrican Journal of Biotechnology200652195200AkomoEFZongoCKarouSDIn vitro antiplasmodial and antibacterial activities of Canthium multiflorum Schum and Thonn (Rubiacea) extractsPakistan Journal of Biological Sciences2009121291992319777786OlilaDOpuda-AsiboJOdyekOBioassay-guided studies on the cytotoxic and in vitro trypanocidal activities of a sesquiterpene (Muzigadial) derived from a Ugandan medicinal plant (Warburgia ugandensis)African Health Sciences200111121512789127KarouSDNadembegaWMCIlboudoDPSida acuta Burm. f.: a medicinal plant with numerous potenciesAfrican Journal of Biotechnology200762529532959KarouDNadembegaWMCOuattaraLAfrican ethnopharmacology and new drug discoveryMedicinal and Aromatic Plant Science and Biotechnology2007116169GertschJHow scientific is the science in ethnopharmacology? Historical perspectives and epistemological problemsJournal of Ethnopharmacology2009122217718319185054NdhlalaARStaffordGIFinnieJFVan StadenJIn vitro pharmacological effects of manufactured herbal concoctions used in KwaZulu-Natal South AfricaJournal of Ethnopharmacology2009122111712219146944von MaydellHTTrees and Shrubs of the Sahel1996Weikersheim, GermanyJosef MargrafAjibesinKKEkpoBABalaDNEssienEEAdesanyaSAEthnobotanical survey of Akwa Ibom State of NigeriaJournal of Ethnopharmacology2008115338740818053664ManderMThe Marketing of Indigenous Medicinal Plants in South Africa: A Case Study in Kwazulu-Natal1997Pietermaritzburg, South AfricaInstitute of Natural ResourcesDjikpo-TchibozoAMAnaniKAmeyapohYEvaluation de la qualité hygiénique de six plantes médicinales et des phytomédicaments traditionnelsPharm Med Trad Afr2001118392AFNOR (Association Française de Normalisation)Normes Agroalimentaires2009, http://www.afnor.org/secteurs/activite/agroalimentaire/normes/liste-des-normeFennellCWLindseyKLMcGawLJAssessing African medicinal plants for efficacy and safety: pharmacological screening and toxicologyJournal of Ethnopharmacology2004942-320521715325724UchenduCNIsekTAntifertility activity of aqueous ethanolic leaf extract of Spondias mombin (Anacardiaceae) in ratsAfrican Health Sciences20088316316719357744Ogwal-OkengJWObuaCAnokbonggoWWAcute toxicity effects of the methanolic extract of Fagara zanthoxyloides (Lam.) root-barkAfrican Health Sciences20033312412614676717ScalbertAHemingwayRWLaksEPQuantitative methods for the estimation tannins in plants tissuesPlants Polyphenols: Synthesis, Properties, Significance1992New York, NY, USAPlenum Press673692ScalbertAAntimicrobial properties of tanninsPhytochemistry1991301238753883FieldJALettingaGHemingwayRWLaksEPToxicity of tannic compounds to microorganismsPlant Polyphenols: Synthesis, Properties, Significance2002New York, NY, USAPlenum Press673692KarouDDickoMHSimporeJTraoreASAntioxidant and antibacterial activities of polyphenols from ethnomedicinal plants of Burkina FasoAfrican Journal of Biotechnology200548823828StaffordGIJägerAKVan StadenJEffect of storage on the chemical composition and biological activity of several popular South African medicinal plantsJournal of Ethnopharmacology200597110711515652284
oai:pubmedcentral.nih.gov:30426142011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30426142135066310.4061/2011/576286Review ArticleThe Use of Endophytes to Obtain Bioactive Compounds and Their Application in Biotransformation ProcessPimentelMariana Recco1MolinaGustavo1DionísioAna Paula1Maróstica JuniorMário Roberto2*PastoreGláucia Maria11Laboratory of Bioflavors,Department of Food Science, School of Food Engineering, University of Campinas, P.O. Box 6121, 13083-862 Campinas, SP, Brazil2Laboratory of Nutrition and Metabolism, Department of Food and Nutrition, School of Food Engineering, University of Campinas, P.O. Box 6121, 13083-862 Campinas, SP, Brazil*Mário Roberto Maróstica Junior: mario@fea.unicamp.br
Endophytes are microorganisms that reside asymptomatically in the tissues of higher plants and are a promising source of novel organic natural metabolites exhibiting a variety of biological activities. The laboratory of Bioaromas (Unicamp, Brazil) develops research in biotransformation processes and functional evaluation of natural products. With the intent to provide subsidies for studies on endophytic microbes related to areas cited before, this paper focuses particularly on the role of endophytes on the production of anticancer, antimicrobial, and antioxidant compounds and includes examples that illustrate their potential for human use. It also describes biotransformation as an auspicious method to obtain novel bioactive compounds from microbes. Biotransformation allows the production of regio- and stereoselective compounds under mild conditions that can be labeled as “natural,” as discussed in this paper.
1. Introduction
The term “endophytes” includes a suite of microorganisms that grow intra-and/or intercelullarly in the tissues of higher plants without causing over symptoms on the plants in which they live, and have proven to be rich sources of bioactive natural products [1, 2]. Mutualism interaction between endophytes and host plants may result in fitness benefits for both partners [3]. The endophytes may provide protection and survival conditions to their host plant by producing a plethora of substances which, once isolated and characterized, may also have potential for use in industry, agriculture, and medicine [4, 5].
Approximately 300 000 plant species growing in unexplored area on the earth are host to one or more endophytes [6], and the presence of biodiverse endophytes in huge number plays an important role on ecosystems with greatest biodiversity, for instance, the tropical and temperate rainforests [5], which are extensively found in Brazil and possess almost 20% of its biotechnological source [7]. Considering that only a small amount of endophytes have been studied, recently, several research groups have been motivated to evaluate and elucidate the potential of these microorganisms applied on biotechnological processes focusing on the production of bioactive compounds.
The production of bioactive substances by endophytes is directly related to the independent evolution of these microorganisms, which may have incorporated genetic information from higher plants, allowing them to better adapt to plant host and carry out some functions such as protection from pathogens, insects, and grazing animals [6]. Endophytes are chemical synthesizer inside plants [8], in other words, they play a role as a selection system for microbes to produce bioactive substances with low toxicity toward higher organisms [6].
Bioactive natural compounds produced by endophytes have been promising potential usefulness in safety and human health concerns, although there is still a significant demand of drug industry for synthetic products due to economic and time-consuming reasons [4]. Problems related to human health such as the development of drug resistance in human pathogenic bacteria, fungal infections, and life threatening virus claim for new therapeutic agents for effective treatment of diseases in human, plants, and animals that are currently unmet [5, 6, 9].
Recent review by Newman and Cragg [10] presented a list of all approved agents from 1981 to 2006, from which a significant number of natural drugs are produced by microbes and/or endophytes. Endophytes provide a broad variety of bioactive secondary metabolites with unique structure, including alkaloids, benzopyranones, chinones, flavonoids, phenolic acids, quinones, steroids, terpenoids, tetralones, xanthones, and others [2]. Such bioactive metabolites find wide-ranging application as agrochemicals, antibiotics, immunosuppressants, antiparasitics, antioxidants, and anticancer agents [11].
Methods to obtain bioactive compounds include the extraction from a natural source, the microbial production via fermentation, or microbial transformation. Extraction from natural sources presents some disadvantages such as dependency on seasonal, climatic and political features and possible ecological problems involved with the extraction, thus calling for innovative approaches to obtain such compounds [12]. Hence, biotechnological techniques by using different microorganisms appear promising alternatives for establishing an inexhaustible, cost-effective and renewable resource of high-value bioactive products and aroma compounds. The biotransformation method has a huge number of applications [13], for instance, it has been extensively employed for the production of volatile compounds [12, 14, 15]. These volatile compounds possess not only sensory properties, but other desirable properties such as antimicrobial (vanillin, essential oil constituents), antifungal and antiviral (some alkanolides), antioxidant (eugenol, vanillin), somatic fat reducing (nootkatone), blood pressure regulating (2-[E]-hexenal), anti-inflammatory properties (1,8-cineole), and others [16].
This paper focuses particularly on the role of endophytes in the production of bioactive compounds, the importance of including endophytic microbes in the screening approach for novel drugs, and the microbial biotransformation process as a novel alternative method to obtain such compounds. It also describes these compounds by different functions, including some examples that illustrate the potential for human use. Finally, structures of some compounds produced by endophytes are shown in Figure 1.
2. Anticancer Compounds
Cancer is a group of diseases characterized by unregulated growth and spread of abnormal cells, which can result in death if not controlled [17]. It has been considered one of the major causes of death worldwide: 7.4 million (about 13% of all deaths) in 2004 [18]. The anticancer drugs show nonspecific toxicity to proliferating normal cells, possess enormous side effects, and are not effective against many forms of cancer [19, 20]. Thus, the cure of cancer has been enhanced mainly due to diagnosis improvements which allow earlier and more precise treatments [20].
There are some evidences that bioactive compounds produced by endophytes could be alternative approaches for discovery of novel drugs, since many natural products from plants, microorganisms, and marine sources were identified as anticancer agents [21]. The anticancer properties of several secondary metabolites from endophytes have been investigated recently. Following, some examples of the potential of endophytes on the production of anticancer agents are cited.
The diterpenoid “Taxol” (also known in the literature as paclitaxel) have generated more attention and interest than any other new drug since its discovery, possibly due to its unique mode of action compared to other anticancer agents [19, 21]. This compound interferes with the multiplication of cancer cells, reducing or interrupting their growth and spreading. FDA (Food and Drug Administration) has approved Taxol for the treatment of advanced breast cancer, lung cancer, and refractory ovarian cancer [22]. Taxol (C47H51NO14) was firstly isolated from the bark of trees belonging to Taxus family (Taxus brevifolia), its most common source [23]. Nevertheless, these trees are rare, slow growing, and produce small amount of Taxol, which explain its high price in the market when obtained by this natural source [19]. Besides, in the context of environmental degradation, the use of plant source as unique option have limited the supply of this drug due to the destructive collection of yew trees [24]. Several reports about Taxol anticancer properties were published since its discovery [25–27], as well as other sources for production of Taxol have been investigated in the last decade.
The isolation of Taxol-producing endophyte Taxomyces andreanae has provided an alternative approach to obtain a cheaper and more available product via microorganism fermentation [28]. After that, Taxol has also been found in a number of different genera of fungal endophytes either associated or not to yews, such as Taxodium distichum [29]; Wollemia nobilis [30]; Phyllosticta spinarum [31]; Bartalinia robillardoides [19]; Pestalotiopsis terminaliae [32]; Botryodiplodia theobromae [33].
Another important anticancer compound is the alkaloid “Camptothecin” (C20H16N2O4), a potent antineoplastic agent which was firstly isolated from the wood of Camptotheca acuminata Decaisne (Nyssaceae) in China [34]. Camptothecin and 10-hydroxycamptothecin are two important precursors for the synthesis of the clinically useful anticancer drugs, topotecan, and irinotecan [35]. Although its potential use in medical treatments, the unmodified Camptothecin suffers from drawbacks that compromises its applications due to very low solubility in aqueous media and high toxicity [36, 37]. On the other hand, some Camptothecin derivatives retain the medicinal properties and can show other benefits without causing over drawbacks in some cases [38, 39]. Therefore, it is desirable to develop strategies for isolation, mixture separation, and production of Camptothecin and its analogues from novel endophytic fungal sources. The anticancer properties of the microbial products Camptothecin and two analogues (9-methoxycamptothecin and 10-hydroxycamptothecin) were already reported. The products were obtained from the endophytic fungi Fusarium solani isolated from Camptotheca acuminate [38]. Several reports have described other Camptothecin (or analogues) producing endophytes [40–44]. Since then, endophytes have been included in many studies purposing new approaches for drug discovery.
“Ergoflavin” (C30H26O14), a dimeric xanthene linked in position 2, belongs to the compound class called ergochromes and was described as a novel anticancer agent isolated from an endophytic fungi growing on the leaves of an Indian medicinal plant Mimusops elengi (Sapotaceae) [45]. “Secalonic acid D” (C32H30O14), a mycotoxin also belonging to ergochrome class, is known to have potent anticancer activities. It was isolated from the mangrove endophytic fungus and observed high cytotoxicity on HL60 and K562 cells by inducing leukemia cell apoptosis [46].
“Phenylpropanoids” have attracted much interest for medicinal use as anticancer, antioxidant, antimicrobial, anti-inflammatory, and immunosuppressive properties [47]. Despite the phenylpropanoids belong to the largest group of secondary metabolites produced by plants, reports showed the production of such compounds by endophytes. The endophytic Penicillium brasilianum, found in root bark of Melia azedarach, promoted the biosynthesis of phenylpropanoid amides [48]. Likewise, two monolignol glucosides, coniferin and syringin, are produced not only by the host plant, but were also recognized by the endophytic Xylariaceae species as chemical signals during the establishment of fungus-plant interactions [49]. Koshino and coworkers characterized two phenylpropanoids and lignan from stromata of Epichloe typhina on Phleum pretense [50]. “Lignans” are other kinds of anticancer agents originated as secondary metabolites through the shikimic acid pathway and display different biological activities that make them interesting in several lines of research [51]. Although their molecular backbone consists only of two phenylpropane units (C6-C3), lignans show enormous structural and biological diversity, especially in cancer chemotherapy [47].
“Podophyllotoxin” (C22H22O8) and analogs are clinically relevant mainly due to their cytotoxicity and antiviral activities and are valued as the precursor to useful anticancer drugs like etoposide, teniposide, and etopophos phosphate [52, 53]. The aryl tetralin lignans, such as podophyllotoxin, are naturally synthesized by Podophyllum sps., however, alternative sources have been searched to avoid endangered plant. Another study showed a novel fungal endophyte, Trametes hirsute, that produces podophyllotoxin and other related aryl tetralin lignans with potent anticancer and properties [54]. Novel microbial sources of Podophyllotoxin were reported from the endophytic fungi Aspergillus fumigatus Fresenius isolated from Juniperus communis L. Horstmann [52], Phialocephala fortinii isolated from Podophyllum peltatum [55], and Fusarium oxysporum from Juniperus recurva [53].
Wagenaar and co-workers reported identification of three novel “cytochalasins”, bearing antitumor activity from the endophyte Rhinocladiella sp. [56]. Extensive experiments identified these new compounds as 22-oxa-12-cytochalasins. “Torreyanic acid” (C38H44O12) is an unusual dimeric quinone isolated from the endophytic fungus Pestalotiopsis microspora from T. taxifolia (Florida torreya) and was proven to have selective cytotoxicity 5 to 10 times more potent in cell lines that are sensitive to protein kinase C agonists and causes cell death by apoptosis [57]. “Gliocladicillins A” and “B” were reported as effective antitumor agents in vitro and in vivo, since they induced tumor cell apoptosis and showed significant inhibition on proliferation of melanoma B16 cells implanted into immunodeficient mice [58].
Crude Extracts of Alternaria alternata, an endophytic fungus isolated from Coffea Arabica L., displayed moderate cytotoxic activity towards HeLa cells in vitro, when compared to the dimethyl sulfoxide-(DMSO-) treated cells [59]. The investigation of endophytic actinomycetes associated with pharmaceutical plants in rainforest reported 41 microorganisms from the genus Streptomyces displayed significant antitumor activity against HL-60 cells, A549 cells, BEL-7404 cells, and P388D1 cells [1]. The screening of endophytic fungi isolated from pharmaceutical plants in China showed that 13.4% endophytes were cytotoxic on HL-60 cells and 6.4% on KB cells [60].
Finally, other compounds with anticancer properties isolated from endophytic microbes were reported such as “cytoskyrins” [61], “phomoxanthones A” and “B” [62], “photinides A-F” [63], “rubrofusarin B” [64], and “(+)-epiepoxydon” [65].
3. Antimicrobial Compounds
Metabolites bearing antibiotic activity can be defined as low-molecular-weight organic natural substances made by microorganisms that are active at low concentrations against other microorganisms [24]. Endophytes are believed to carry out a resistance mechanism to overcome pathogenic invasion by producing secondary metabolites [2]. So far, studies reported a large number of antimicrobial compounds isolated from endophytes, belonging to several structural classes like alkaloids, peptides, steroids, terpenoids, phenols, quinines, and flavonoids [66].
The discovery of novel antimicrobial metabolites from endophytes is an important alternative to overcome the increasing levels of drug resistance by plant and human pathogens, the insufficient number of effective antibiotics against diverse bacterial species, and few new antimicrobial agents in development, probably due to relatively unfavorable returns on investment [66, 67]. The antimicrobial compounds can be used not only as drugs by humankind but also as food preservatives in the control of food spoilage and food-borne diseases, a serious concern in the world food chain [68].
Many bioactive compounds, including antifungal agents, have been isolated from the genus Xylaria residing in different plant hosts, such as “sordaricin” with antifungal activity against Candida albicans [69]; “mellisol” and “1,8-dihydroxynaphthol 1-O-a-glucopyranoside” with activity against herpes simplex virus-type 1 [70]; “multiplolides A and B” with activity against Candida albicans [71]. The bioactive compound isolated from the culture extracts of the endophytic fungus Xylaria sp. YX-28 isolated from Ginkgo biloba L. was identified as “7-amino-4-methylcoumarin” [68]. The compound presented broad-spectrum inhibitory activity against several food-borne and food spoilage microorganisms including S. aureus, E. coli, S. typhia, S. typhimurium, S. enteritidis, A. hydrophila, Yersinia sp., V. anguillarum, Shigella sp., V. parahaemolyticus, C. albicans, P. expansum, and A. niger, especially to A. hydrophila, and was suggested to be used as natural preservative in food [68].
Another strain F0010 of the endophytic fungus Xylaria sp. from Abies holophylla was characterized as a producer of “griseofulvin” (C17H17ClO6), a spirobenzofuran antifungal antibiotic agent used for the treatment of human and veterinary animals mycotic diseases [72]. They evaluated and reported high antifungal activity in vivo and in vitro of the endophyte-produced griseofulvin against plant pathogenic fungi, controlling effectively the development of various food crops.
Aliphatic compounds, frequently detected in cultures of endophytes, often show biological activities. Four antifungal “aliphatic compounds” were characterized from stromata of E. typhina on P. pratense [73]. Two novel ester metabolites isolated from an endophyte of the eastern larch presented antimicrobial activity. One compound was toxic to spruce budworm (Choristoneura fumiferana Clem.) larvae, and the other may serve as potent antibacterial agent against Vibrio salmonicida, Pseudomonas aeruginosa, and Staphylococcus aureus [74].
Chaetomugilin A and D with antifungal activities, were isolated from an endophytic fungus C. globosum collected from Ginkgo biloba [75]. Cytosporone B and C were isolated from a mangrove endophytic fungus, Phomopsis sp. They inhibited two fungi C. albicans and F. oxysporum with the MIC value ranging from 32 to 64 mg·mL−1 [76].
Chlorinated metabolites such as (−)-mycorrhizin A, (+)-cryptosporiopsin isolated from endophytic Pezicula strains were reported as strongly fungicidal and herbicidal agents, and to a lesser extent, as algicidal and antibacterial agents [77]. Similarly, two other new chlorinated benzophenone derivatives, “Pestalachlorides A” (C21H21Cl2NO5) and “B” (C20H18Cl2O5), from the plant endophytic fungus Pestalotiopsis adusta, proven to display significant antifungal activity against three plant pathogenic fungi, Fusarium culmorum, Gibberella zeae, and Verticillium albo-atrum [78].
The production of “Hypericin” (C30H16O8), a naphthodianthrone derivative, and “Emodin” (C15H10O5) believed to be the main precursor of hypericin, by the endophytic fungus isolated from an Indian medicinal plant, was reported. Both compounds demonstrated antimicrobial activity against several bacteria and fungi, including Staphylococcus aureus ssp. aureus, Klebsiella pneumoniae ssp. ozaenae, Pseudomonas aeruginosa, Salmonella enterica ssp. Enteric, and Escherichia coli, and fungal organisms Aspergillus niger and Candida albicans [79].
An endophytic Streptomyces sp. from a fern-leaved grevillea (Grevillea pteridifolia) in Australia was described as a promising producer of novel antibiotics, “kakadumycin A” and “echinomycin”. Kakadumycin A is structurally related to echinomycin, a quinoxaline antibiotic, and presents better bioactivity than echinomycin especially against Gram-positive bacteria and impressive activity against the malarial parasite Plasmodium falciparum [80].
More than 50% of endophytic fungi strains residing in Quercus variabilis possessed growth inhibition against at least one pathogenic fungi or bacteria. Cladosporium sp., displaying the most active antifungal activity, was investigated and found to produce a secondary metabolite known as “brefeldin A” (C16H24O4), a lactone with antibiotic activity. Results showed brefeldin A to be more potent than the positive control in antifungal activity [81].
“Coronamycin”, a peptide antibiotic produced by an endophytic fungi Streptomyces sp. isolated from Monstera sp., is active against pythiaceous fungi, the human fungal pathogen Cryptococcus neoformans, and the malarial parasite, Plasmodium falciparum [82]. Production of lipopeptide “pumilacidin”, an antifungal compound, by B. pumilus isolated from cassava cultivated by Brazilian Amazon Indian tribes was described for the first time [83]. The compounds “2-hexyl-3-methyl-butanodioic acid” and “cytochalasin D” were isolated from the endophytic fungus Xylaria sp. isolated from Brazilian Cerrado, and presented antifungal activity [84]. Two new bioactive metabolites, “ethyl 2,4-dihydroxy-5,6-dimethylbenzoate” and “phomopsilactone” were isolated from an endophytic fungus Phomopsis cassiae from Cassia spectabilis and displayed strong antifungal activity against two phytopathogenic fungi, Cladosporium cladosporioides, and C. sphaerospermum [85]. The polyketide “citrinin”, produced by endophytic fungus Penicillium janthinellum from fruits of Melia azedarach, presented 100% antibacterial activity against Leishmania sp. [86].
Among the 12 secondary metabolites produced by the endophytic fungi Aspergillus fumigatus CY018 isolated from the leaf of Cynodon dactylon, “asperfumoid”, “fumigaclavine C”,“fumitremorgin C”, “ physcion”, and “helvolic acid” were shown to inhibit Candida albicans [87]. Endophyte Verticillium sp. isolated from roots of wild Rehmannia glutinosa produced two compounds “2,6-Dihydroxy-2-methyl-7-(prop-1E-enyl)-1-benzofuran-3(2H)-one”, reported for the first time, and “ergosterol peroxide” with clear inhibition of the growth of three pathogens including Verticillium sp. [88]. An endophytic fungus Pestalotiopsis theae of an unidentified tree on Jianfeng Mountain, China, was capable of producing “Pestalotheol C” with anti-HIV properties [89].
Other secondary metabolites with antimicrobial properties isolated from endophytic microbes were reported like “3-O-methylalaternin” and “altersolanol A” [90], “phomoenamide” [91], “phomodione” [92], “ambuic acid” [93], “isopestacin” [6], and “munumbicin A, B, C” and “D” [94].
4. Antioxidant Compounds
The importance of compounds bearing antioxidant activity lays in the fact that they are highly effective against damage caused by reactive oxygen species (ROSs) and oxygen-derived free radicals, which contribute to a variety of pathological effects, for instance, DNA damages, carcinogenesis, and cellular degeneration [95, 96]. Antioxidants have been considered promising therapy for prevention and treatment of ROS-linked diseases as cancer, cardiovascular disease, atherosclerosis, hypertension, ischemia/reperfusion injury, diabetes mellitus, neurodegenerative diseases (Alzheimer and Parkinson diseases), rheumatoid arthritis, and ageing [97]. Many antioxidant compounds possess anti-inflammatory, antiatherosclerotic, antitumor, antimutagenic, anticarcinogenic, antibacterial, or antiviral activities in higher or lower level [98–102].
Natural antioxidants are commonly found in medicinal plants, vegetables, and fruits. However, it has been reported that metabolites from endophytes can be a potential source of novel natural antioxidants. Liu and coworkers evaluated the antioxidant activity of an endophytic Xylaria sp. isolated from the medicinal plant Ginkgo biloba [103]. The results collected indicated that the methanol extract exhibited strong antioxidant capacity due to the presence of “phenolics” and “flavonoids” compounds among 41 identified compounds. Huang and coworkers investigated the antioxidant capacities of endophytic fungal cultures of medicinal Chinese plants and its correlation to their total phenolic contents. They suggested that the phenolic content were the major antioxidant constituents of the endophytes [95].
“Pestacin” (C15H14O4) and “isopestacin”, 1,3-dihydro isobenzofurans, were obtained from the endophytic fungus Pestalotiopsis microspora isolated from a plant growing in the Papua New Guinea, Terminalia morobensis [104, 105]. Besides antioxidant activity, pestacin and isopestacin also presented antimycotic and antifungal activities, respectively. Pestacin is believed to have antioxidant activity 11 times greater than Trolox, a vitamin E derivative, primarily via cleavage of an unusually reactive C-H bond and to a lesser extent, O-H abstraction [104]. Isopestacin possess antioxidant activity by scavenging both superoxide and hydroxy free radicals in solution, added to the fact that isopestacin is structurally similar to the flavonoids [105].
Polysaccharides from plants and microorganisms have been extensively studied and considered as potent natural antioxidants [58, 106–109]. Liu and coworkers reported, for the first time, the capacity of endophytic microorganisms to produce polysaccharides with antioxidant. The bacterium endophyte Paenibacillus polymyxa isolated from the root tissue of Stemona japonica Miquel, a traditional Chinese medicine, produced “exopolysaccharides (EPS)” that demonstrated strong scavenging activities on superoxide and hydroxyl radicals [110].
“Graphislactone A”, a phenolic metabolite isolated from the endophytic fungus Cephalosporium sp. IFB-E001 residing in Trachelospermum jasminoides, demonstrated to have free radical-scavenging and antioxidant activities in vitro stronger than the standards, butylated hydroxytoluene (BHT) and ascorbic acid, coassayed in the study [111].
For more detailed information on antimicrobial, antioxidant, and anticancer agents from microbial source, the references Newman and Cragg [10] and Firáková and coworkers [21] are recommended.
5. Biotransformation Process
Biotransformation can be defined as the use of biological systems to produce chemical changes on compounds that are not their natural substrates [112]. The microbial growth, sustenance, and reproduction depends on the availability of a suitable form of reduced carbon source, used as chemical energy, which under normal conditions of culture broth are the common sugars. Nevertheless, microorganisms are believed to have no limit to adapt to new environments and to metabolize various foreign substrates to carbon and nitrogen sources [113]. A molecule can be modified by transforming functional groups, with or without degradation of carbon skeleton. Such modifications result in the formation of novel and useful products not easily prepared by chemical methods [13].
The biotransformation process provides a number of advantages over chemical synthesis. The process can be carried out under mild conditions like ambient temperature and without the need of high pressure and extreme conditions, thus reducing undesired byproduct, energy needs, and cost [114]. The region-and stereo-selectivity of the process allows the production of enantiomerically pure compounds, eliminating the need for complicated separation and purification steps [112, 115]. Besides, the reactions occur under ecologically acceptable conditions, with lower emission of industrial resides and production of biodegradable resides and products, thus reducing the environmental problems [12, 116]. Finally, the products obtained by biotransformation process can be labeled as “natural.” On the other hand, chemical synthesis often result in environmentally unfriendly production processes and lacks substrate selectivity, possibly causing the formation of undesirable reaction mixtures, and reducing process efficiency and increasing downstream cost [117].
Therefore, biotransformation is a useful method for production of novel compounds; enhancement in the productivity of a desired compound; overcoming the problems associated with chemical analysis; leading to basic information to elucidate the biosynthetic pathway [114]. For this reason, biotransformation using microbial cultures and/or their enzymatic systems alone has received increasing attention as a method for the conversion of lipids, monoterpenes, diterpenes, steroids, triterpenes, alkaloids, lignans, and some synthetic chemicals, carrying out stereospecific and stereoselective reactions for the production of novel bioactive molecules with some potential for pharmaceutical and food industries [13, 118].
Endophytic microorganisms are able to produce necessary enzymes for the colonization of plant tissues, and to use, at least in vitro, most plant nutrients and components [21]. Therefore, more recently, endophytes have received attention as biocatalysts in the chemical transformation of natural products and drugs, due to their ability to modify chemical structures with a high degree of stereospecificity and to produce known or novel enzymes that facilitates the production of compounds of interest. Although the high potential of these microorganisms, studies using endophytes in the field of biotransformation are still limited.
The biotransformation of a tetrahydrofuran lignan, (−)-grandisin, by the endophytic fungus Phomopsis sp. from Viguiera arenaria was demonstrated by Verza and coworkers [119]. The process led to the formation of a new compound named as “3,4-dimethyl-2-(4′-hydroxy-3′, 5′-dimethoxyphenyl)-5-methoxy-tetrahydrofuran”, which showed trypanocidal activity similar to its natural corresponding precursor against the causative agent of Chagas disease, the parasite Trypanosoma cruzi. Zikmundová and coworkers reported an endophytic fungus isolated from the roots and shoots of Aphelandra tetragona, capable to transform benzoxazinones, 2-benzoxazolinone (BOA) and 2-hydroxy-1,4-benzoxazin-3-one (HBOA), into different series of compounds [120].
The use of endophytic fungi in the stereoselective kinetic biotransformation of “thioridazine (THD)”, a phenothiazine neuroleptic drug, was investigated. Results showed that these microorganisms are able to biomimic mammalian metabolism via biotransformation reactions [112]. Another study employed endophytic fungus on the biotransformation of “propranolol (Prop)” to obtain 4-OH-Prop active metabolite in enantiomerically pure form [13].
Another interesting topic in biotransformation process is the use of endophytes in the biotransformation of terpenes for production of novel compounds through enzymatic reactions carried out by these microbes. “Terpenes” are large class of bioactive secondary metabolites used in the fragrance and flavor industries, and have been extensively used in biotransformation process by microorganisms with focus on the discovery of novel flavor compounds and on the optimization of the process condition [12]. Microbial transformations of terpenes were published recently using R-(+)-limonene [14, 121], L-menthol [122], α- and β-pinene [123, 124], and α-farnesene [15], by diverse microorganisms. However, some research groups have also investigated studies with the biotransformation of terpenes by endophytes.
Other endophytic microbes were studied for the capability to biotransform natural products like taxoids [125], alkaloids [126], pigment curcumim [127], betulinic, and betulonic acids [128].
6. Conclusion
Endophytes have proven to be rich sources of novel natural compounds with a wide-spectrum of biological activities and a high level of structural diversity. The use of endophytes as biocatalysts in the biotransformation process of natural products assumes greater importance. However, the application of microorganisms by the food and pharmaceutical industries to obtain compounds of interest is still modest, considering the great availability of useful microorganisms and the large scope of reactions that can be accomplished by them.
Acknowledgment
The authors acknowledge Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) for the financial support.
LiJZhaoG-ZChenH-HAntitumour and antimicrobial activities of endophytic streptomycetes from pharmaceutical plants in rainforestLetters in Applied Microbiology200847657458019120929TanRXZouWXEndophytes: a rich source of functional metabolitesNatural Product Reports200118444845911548053KogelK-HFrankenPHückelhovenREndophyte or parasite—what decides?Current Opinion in Plant Biology20069435836316713330StrobelGDaisyBCastilloUHarperJNatural products from endophytic microorganismsJournal of Natural Products200467225726814987067StrobelGDaisyBBioprospecting for microbial endophytes and their natural productsMicrobiology and Molecular Biology Reviews200367449150214665674StrobelGAEndophytes as sources of bioactive productsMicrobes and Infection20035653554412758283SouzaAQLSouzaADLAstolfi FilhoSBelém PinheiroMLSarquisMIMPereiraJOAtividade antimicrobiana de fungos endofíticos isolados de plantas tóxicas da Amazônia: Palicourea longiflora (aubl.) rich e Strychnos cogens benthamACTA Amazônica200434185195OwenNLHundleyNEndophytes—the chemical synthesizers inside plantsScience Progress2004872799915782772ZhangLAnRWangJExploring novel bioactive compounds from marine microbesCurrent Opinion in Microbiology20058327628115939350NewmanDJCraggGMNatural products as sources of new drugs over the last 25 yearsJournal of Natural Products200770346147717309302GunatilakaAALNatural products from plant-associated microorganisms: distribution, structural diversity, bioactivity, and implications of their occurrenceJournal of Natural Products200669350952616562864BicasJLDionísioAPPastoreGMBio-oxidation of terpenes: an approach for the flavor industryChemical Reviews200910994518453119645444BorgesKBBorgesWDSDurán-PatrónRPupoMTBonatoPSColladoIGStereoselective biotransformations using fungi as biocatalystsTetrahedron Asymmetry2009204385397BicasJLBarrosFFCWagnerRGodoyHTPastoreGMOptimization of R-(+)-α-terpineol production by the biotransformation of R-(+)-limoneneJournal of Industrial Microbiology and Biotechnology20083591061107018560915KringsUHardebuschBAlbertDBergerRGMarósticaMJr.PastoreGMOdor-active alcohols from the fungal transformation of α-farneseneJournal of Agricultural and Food Chemistry200654249079908417117793BergerRGBiotechnology of flavours-the next generationBiotechnology Letters200931111651165919609491American Cancer SocietyCancer Facts & Figures 2009American Cancer Society, Atlanta, Ga, USA, 2009WHO Mortality DatabaseFact sheet No. 297. February 2009GangadeviVMuthumaryJTaxol, an anticancer drug produced by an endophytic fungus Bartalinia robillardoides Tassi, isolated from a medicinal plant, Aegle marmelos Correa ex RoxbWorld Journal of Microbiology and Biotechnology2008245717724PasutGVeroneseFMPEG conjugates in clinical development or use as anticancer agents: an overviewAdvanced Drug Delivery Reviews200961131177118819671438FirákováSŠturdíkováMMúčkováMBioactive secondary metabolites produced by microorganisms associated with plantsBiologia2007623251257CremascoMAHritzkoBJLinda WangN-HExperimental purification of paclitaxel from a complex mixture of taxanes using a simulated moving bedBrazilian Journal of Chemical Engineering2009261207218WaniMCTaylorHLWallMECoggonPMcPhailATPlant antitumor agents. VI. The isolation and structure of taxol, a novel antileukemic and antitumor agent from Taxus brevifoliaJournal of the American Chemical Society1971939232523275553076GuoBWangYSunXTangKBioactive natural products from endophytes: a reviewApplied Biochemistry and Microbiology2008442136142LuHLiBKangYPaclitaxel nanoparticle inhibits growth of ovarian cancer xenografts and enhances lymphatic targetingCancer Chemotherapy and Pharmacology200659217518116718469KakolyrisSAgelidouAAndroulakisNCisplatin plus etoposide chemotherapy followed by thoracic irradiation and paclitaxel plus cisplatin consolidation therapy for patients with limited stage small cell lung carcinomaLung Cancer2006531596516716447PeltierSOgerJ-MLagarceFCouetWBenoîtJ-PEnhanced oral paclitaxel bioavailability after administration of paclitaxel-loaded lipid nanocapsulesPharmaceutical Research20062361243125016715372StierleAStrobelGStierleDTaxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yewScience199326051052142168097061LiJ-YStrobelGSidhuRHessWMFordEJEndophytic taxol-producing fungi from bald cypress, Taxodium distichumMicrobiology19961428222322268760934StrobelGAHessWMLiJ-YPestalotiopsis guepinii, a taxol-producing endophyte of the wollemi pine, Wollemia nobilisAustralian Journal of Botany199745610731082KumaranRSMuthumaryJHurBKProduction of taxol from Phyllosticta spinarum, an endophytic fungus of Cupressus spEngineering in Life Sciences200884438446GangadeviVMuthumaryJTaxol production by Pestalotiopsis terminaliae, an endophytic fungus of Terminalia arjuna (arjun tree)Biotechnology and Applied Biochemistry200952191518254723PandiMManikandanRMuthumaryJAnticancer activity of fungal taxol derived from Botryodiplodia theobromae Pat., an endophytic fungus, against 7, 12 dimethyl benz(a)anthracene (DMBA)-induced mammary gland carcinogenesis in Sprague dawley ratsBiomedicine and Pharmacotherapy2010644853WallMEWaniMCCookCEPalmerKHMcPhailATSimGAPlant antitumor agents. I. The isolation and structure of camptothecin, a novel alkaloidal leukemia and tumor inhibitor from Camptotheca acuminataJournal of the American Chemical Society1966881638883890UmaSRRameshaBTRavikanthGRajeshPGVasudevaRGaneshaiahKNRamawatKGMerillionJChemical profiling of N. nimmoniana for camptothecin, an important anticancer alkaloid: towards the development of a sustainable production systemBioactive Molecules and Medicinal Plants2008Berlin, GermanySpringer198210LiQ-YZuY-GShiR-ZYaoL-PReview camptothecin: current perspectivesCurrent Medicinal Chemistry200613172021203916842195KehrerDFSSoepenbergOLoosWJVerweijJSparreboomAModulation of camptothecin analogs in the treatment of cancer: a reviewAnti-Cancer Drugs20011228910511261892KusariSZühlkeSSpitellerMAn endophytic fungus from Camptotheca acuminata that produces camptothecin and analoguesJournal of Natural Products20097212719119919JewS-SKimH-JGoo KimMSynthesis and in vitro cytotoxicity of hexacyclic Camptothecin analoguesBioorganic and Medicinal Chemistry Letters19999223203320610576688ShwetaSZuehlkeSRameshaBTEndophytic fungal strains of Fusarium solani, from Apodytes dimidiata E. Mey. ex Arn (Icacinaceae) produce camptothecin, 10-hydroxycamptothecin and 9-methoxycamptothecinPhytochemistry201071111712219863979LiuKDingXDengBChenW10-Hydroxycamptothecin produced by a new endophytic Xylaria sp., M20, from Camptotheca acuminataBiotechnology Letters201032568969320112128RehmanSShawlASKourAAn endophytic Neurospora sp. from Nothapodytes foetida producing camptothecinApplied Biochemistry and Microbiology2008442203209AmnaTPuriSCVermaVBioreactor studies on the endophytic fungus entrophospora infrequens for the production of an anticancer alkaloid camptothecinCanadian Journal of Microbiology200652318919616604115PuriSGVermaVAmnaTQaziGNSpitellerMAn endophytic fungus from Nothapodytes foetida that produces camptothecinJournal of Natural Products200568121717171916378360DeshmukhSKMishraPDKulkarni-AlmeidaAAnti-inflammatory and anticancer activity of ergoflavin isolated from an endophytic fungusChemistry and Biodiversity20096578478919479845ZhangJ-YTaoL-YLiangY-JSecalonic acid D induced leukemia cell apoptosis and cell cycle arrest of G1 with involvement of GSK-3β/β-catenin/c-Myc pathwayCell Cycle20098152444245019571678KorkinaLGPhenylpropanoids as naturally occurring antioxidants: from plant defense to human healthCellular and Molecular Biology2007531152517519109FillTPda SilvaBFRodrigues-FoEBiosynthesis of phenylpropanoid amides by an endophytic penicillium brasilianum found in root bark of Melia azedarachJournal of Microbiology and Biotechnology201020362262920372037ChapelaIHPetriniOHagmannLMonolignol glucosides as specific recognition messengers in fungus-plant symbiosesPhysiological and Molecular Plant Pathology1991394289298KoshinoHTeradaS-IYoshiharaTThree phenolic acid derivatives from stromata of Epichloe typhina on Phleum pratensePhytochemistry198827513331338GordalizaMGarcíaPAMiguel Del CorralJMCastroMAGómez-ZuritaMAPodophyllotoxin: distribution, sources, applications and new cytotoxic derivativesToxicon200444444145915302526KusariSLamshöftMSpitellerMAspergillus fumigatus Fresenius, an endophytic fungus from Juniperus communis L. Horstmann as a novel source of the anticancer pro-drug deoxypodophyllotoxinJournal of Applied Microbiology200910731019103019486398KourAShawlASRehmanSIsolation and identification of an endophytic strain of Fusarium oxysporum producing podophyllotoxin from Juniperus recurvaWorld Journal of Microbiology and Biotechnology200824711151121PuriSCNazirAChawlaRThe endophytic fungus Trametes hirsuta as a novel alternative source of podophyllotoxin and related aryl tetralin lignansJournal of Biotechnology2006122449451016375985EybergerALDondapatiRPorterJREndophyte fungal isolates from Podophyllum peltatum produce podophyllotoxinJournal of Natural Products20066981121112416933860WagenaarMMCorwinJStrobelGClardyJThree new cytochalasins produced by an endophytic fungus in the genus RhinocladiellaJournal of Natural Products200063121692169511141120LeeJCStrobelGALobkovskyEClardyJTorreyanic acid: a selectively cytotoxic quinone dimer from the endophytic fungus Pestalotiopsis microsporaJournal of Organic Chemistry1996611032323233ChenYGuoHDuZLiuX-ZCheYYeXEcology-based screen identifies new metabolites from a Cordyceps-colonizing fungus as cancer cell proliferation inhibitors and apoptosis inducersCell Proliferation200942683884719673894FernandesMDRVSilvaTACPfenningLHBiological activities of the fermentation extract of the endophytic fungus Alternaria alternata isolated from Coffea arabica LBrazilian Journal of Pharmaceutical Sciences2009454677685HuangYWangJLiGZhengZSuWAntitumor and antifungal activities in endophytic fungi isolated from pharmaceutical plants Taxus mairei, Cephalataxus fortunei and Torreya grandisFEMS Immunology and Medical Microbiology200131216316711549424BradySFSinghMPJansoJEClardyJCytoskyrins A and B, new BIA active bisanthraquinones isolated from an endophytic fungusOrganic Letters20002254047404911112640IsakaMJaturapatARuksereeKDanwisetkanjanaKTanticharoenMThebtaranonthYPhomoxanthones A and B, novel xanthone dimers from the endophytic fungus Phomopsis speciesJournal of Natural Products20016481015101811520217DingGZhengZLiuSZhangHGuoLCheYPhotinides A-F, cytotoxic benzofuranone-derived γ-lactones from the plant endophytic fungus Pestalotiopsis photiniaeJournal of Natural Products200972594294519371070SongYCLiHYeYHShanCYYangYMTanRXEndophytic naphthopyrone metabolites are co-inhibitors of xanthine oxidase, SW1116 cell and some microbial growthsFEMS Microbiology Letters20042411677215556711KlemkeCKehrausSWrightADKönigGMNew secondary metabolites from the marine endophytic fungus Apiospora montagneiJournal of Natural Products20046761058106315217297YuHZhangLLiLRecent developments and future prospects of antimicrobial metabolites produced by endophytesMicrobiological Research2010165643744920116229SongJ-HWhat’s new on the antimicrobial horizon?International Journal of Antimicrobial Agents2008324S207S21319134521LiuXDongMChenXJiangMLvXZhouJAntimicrobial activity of an endophytic Xylaria sp.YX-28 and identification of its antimicrobial compound 7-amino-4-methylcoumarinApplied Microbiology and Biotechnology200878224124718092158PongcharoenWRukachaisirikulVPhongpaichitSMetabolites from the endophytic fungus Xylaria sp. PSU-D14Phytochemistry20086991900190218495187PittayakhajonwutPSuvannakadRThienhirunSPrabpaiSKongsaereePTanticharoenMAn anti-herpes simplex virus-type 1 agent from Xylaria mellisii (BCC 1005)Tetrahedron Letters200546813411344BoonphongSKittakoopPIsakaMPittayakhajonwutDTanticharoenMThebtaranonthYMultiplolides A and B, new antifungal 10-membered lactones from Xylaria multiplexJournal of Natural Products200164796596711473437ParkJ-HChoiGJLeeHBGriseofulvin from Xylaria sp. strain F0010, an endophytic fungus of Abies holophylla and its antifungal activity against plant pathogenic fungiJournal of Microbiology and Biotechnology2005151112117KoshinoHYoshiharaTSakamuraSShimanukiTSatoTTajimiANovel C-11 epoxy fatty acid from stromata of Epichloe typhina on Phleum pratenseAgricultural Biology and Chemistry19895325272528FindlayJALiGJohnsonJABioactive compounds from an endophytic fungus from eastern larch (Larix laricina) needlesCanadian Journal of Chemistry1997756716719QinJ-CZhangY-MGaoJ-MBioactive metabolites produced by Chaetomium globosum, an endophytic fungus isolated from Ginkgo bilobaBioorganic and Medicinal Chemistry Letters20091961572157419246197HuangZCaiXShaoCChemistry and weak antimicrobial activities of phomopsins produced by mangrove endophytic fungus Phomopsis sp. ZSU-H76Phytochemistry20086971604160818343465SchulzBSuckerJAustHJBiologically active secondary metabolites of endophytic Pezicula speciesMycological Research199599810071015LiEJiangLGuoLZhangHCheYPestalachlorides A-C, antifungal metabolites from the plant endophytic fungus Pestalotiopsis adustaBioorganic and Medicinal Chemistry200816177894789918694644KusariSLamshöftMZühlkeSSpitellerMAn endophytic fungus from Hypericum perforatum that produces hypericinJournal of Natural Products200871215916218220354CastilloUHarperJKStrobelGAKakadumycins, novel antibiotics from Streptomyces sp. NRRL 30566, an endophyte of Grevillea pteridifoliaFEMS Microbiology Letters2003224218319012892881WangFWJiaoRHChengABTanSHSongYCAntimicrobial potentials of endophytic fungi residing in Quercus variabilis and brefeldin A obtained from Cladosporium spWorld Journal of Microbiology and Biotechnology20072317983EzraDCastilloUFStrobelGACoronamycins, peptide antibiotics produced by a verticillate Streptomyces sp. (MSU-2110) endophytic on Monstera spMicrobiology2004150478579315073289de MeloFMPFioreMFde MoraesLABAntifungal compound produced by the cassava endophyte Bacillus pumilus MAIIIM4AScientia Agricola2009665583592CafêuMCSilvaGHTelesHLAntifungal compounds of Xylaria sp., an endophytic fungus isolated from Palicourea marcgravii (Rubiaceae)Quimica Nova2005286991995SilvaGHTelesHLTrevisanHCNew bioactive metabolites produced by Phomopsis cassiae, an endophytic fungus in Cassia spectabilisJournal of the Brazilian Chemical Society2005166 B14631466MarinhoAMRRodrigues-FilhoEMoitinhoMDLRSantosLSBiologically active polyketides produced by Penicillium janthinellum isolated as an endophytic fungus from fruits of Melia azedarachJournal of the Brazilian Chemical Society2005162280283LiuJYSongYCZhangZAspergillus fumigatus CY018, an endophytic fungus in Cynodon dactylon as a versatile producer of new and bioactive metabolitesJournal of Biotechnology2004114327928715522437YouFHanTWuJ-ZHuangB-KQinL-PAntifungal secondary metabolites from endophytic Verticillium spBiochemical Systematics and Ecology2009373162165LiETianRLiuSChenXGuoLCheYPestalotheols A-D, bioactive metabolites from the plant endophytic fungus Pestalotiopsis theaeJournal of Natural Products200871466466818303847AlyAHEdrada-EbelRWrayVBioactive metabolites from the endophytic fungus Ampelomyces sp. isolated from the medicinal plant Urospermum picroidesPhytochemistry20086981716172518400237RukachaisirikulVSommartUPhongpaichitSSakayarojJKirtikaraKMetabolites from the endophytic fungus Phomopsis sp. PSU-D15Phytochemistry200869378378717950385HoffmanAMMayerSGStrobelGAPurification, identification and activity of phomodione, a furandione from an endophytic Phoma speciesPhytochemistry20086941049105618070629LiJYHarperJKGrantDMAmbuic acid, a highly functionalized cyclohexenone with antifungal activity from Pestalotiopsis spp. and Monochaetia spPhytochemistry200156546346811261579CastilloUFStrobelGAFordEJMunumbicins, wide-spectrum antibiotics produced by Streptomyces NRRL 30562, endophytic on Kennedia nigriscansMicrobiology200214892675268512213914HuangW-YCaiY-ZXingJCorkeHSunMA potential antioxidant resource: endophytic fungi from medicinal plantsEconomic Botany20076111430SeifriedHEAndersonDEFisherEIMilnerJAA review of the interaction among dietary antioxidants and reactive oxygen speciesJournal of Nutritional Biochemistry200718956757917360173ValkoMLeibfritzDMoncolJCroninMTDMazurMTelserJFree radicals and antioxidants in normal physiological functions and human diseaseInternational Journal of Biochemistry and Cell Biology2007391448416978905OwenRWGiacosaAHullWEHaubnerRSpiegelhalderBBartschHThe antioxidant/anticancer potential of phenolic compounds isolated from olive oilEuropean Journal of Cancer200036101235124710882862CozmaLSThe role of antioxidant therapy in cardiovascular diseaseCurrent Opinion in Lipidology200415336937115166796HalliwellBFree radicals, antioxidants, and human disease: curiosity, cause, or consequence?The Lancet19943448924721724MitscherLATelikepalliHMcGheeEShankelDMNatural antimutagenic agentsMutation Research 199635011431528657175SalaADel Carmen RecioMGinerRMAnti-inflammatory and antioxidant properties of Helichrysum italicumJournal of Pharmacy and Pharmacology200254336537111902802LiuXDongMChenXJiangMLvXYanGAntioxidant activity and phenolics of an endophytic Xylaria sp. from Ginkgo bilobaFood Chemistry20071052548554HarperJKArifAMFordEJPestacin: a 1,3-dihydro isobenzofuran from Pestalotiopsis microspora possessing antioxidant and antimycotic activitiesTetrahedron2003591424712476StrobelGFordEWorapongJIsopestacin, an isobenzofuranone from Pestalotiopsis microspora, possessing antifungal and antioxidant activitiesPhytochemistry200260217918312009322KardošováAMachováEAntioxidant activity of medicinal plant polysaccharidesFitoterapia200677536737316797146LuoDFangBStructural identification of ginseng polysaccharides and testing of their antioxidant activitiesCarbohydrate Polymers2008723376381SunCWangJ-WFangLGaoX-DTanR-XFree radical scavenging and antioxidant activities of EPS2, an exopolysaccharide produced by a marine filamentous fungus Keissleriella sp. YS 4108Life Sciences20047591063107315207654YuRYangWSongLYanCZhangZZhaoYStructural characterization and antioxidant activity of a polysaccharide from the fruiting bodies of cultured Cordyceps militarisCarbohydrate Polymers2007704430436LiuJLuoJYeHSunYLuZZengXProduction, characterization and antioxidant activities in vitro of exopolysaccharides from endophytic bacterium Paenibacillus polymyxa EJS-3Carbohydrate Polymers2009782275281SongYCHuangWYSunCWangFWTanRXCharacterization of graphislactone A as the antioxidant and free radical-scavenging substance from the culture of Cephalosporium sp. IFB-E001, an endophytic fungus in Trachelospermum jasminoidesBiological and Pharmaceutical Bulletin200528350650915744078BorgesKBBorgesWDSPupoMTBonatoPSEndophytic fungi as models for the stereoselective biotransformation of thioridazineApplied Microbiology and Biotechnology200777366967417876580DobleMKruthiventiAKGaikarVGBiotransformations and Bioprocesses2004New York, NY, USAMarcel DekkerSureshBRituTRavishankarGABiotransformations as applicable to food industriesFood Biotechnology20062nd editionNew York, NY, USATaylor and Francis16551690BorgesKBBorgesWDSPupoMTBonatoPSStereoselective analysis of thioridazine-2-sulfoxide and thioridazine-5-sulfoxide: an investigation of rac-thioridazine biotransformation by some endophytic fungiJournal of Pharmaceutical and Biomedical Analysis200846594595217614234AleuJColladoIGBiotransformations by Botrytis speciesJournal of Molecular Catalysis2001134–67793LongoMASanrománMAProduction of food aroma compounds: microbial and enzymatic methodologiesFood Technology and Biotechnology2006443335353FigueiredoACAlmendraMJBarrosoJGSchefferJJCBiotransformation of monoterpenes and sesquiterpenes by cell suspension cultures of Achillea millefolium L. ssp. MillefoliumBiotechnology Letters1996188863868VerzaMArakawaNSLopesNPBiotransformation of a tetrahydrofuran lignan by the endophytic fungus Phomopsis spJournal of the Brazilian Chemical Society2009201195200ZikmundováMDrandarovKBiglerLHesseMWernerCBiotransformation of 2-benzoxazolinone and 2-hydroxy-1,4-benzoxazin-3-one by endophytic fungi isolated from Aphelandra tetragonaApplied and Environmental Microbiology200268104863487012324332MarósticaMRJr.PastoreGMProduction of R-(+)-α-terpineol by the biotransformation of limonene from orange essential oil, using cassava waste water as mediumFood Chemistry20071011345350MiyazawaMKawazoeHHyakumachiMBiotransformation of l-menthol by twelve isolates of soil-borne plant pathogenic fungi (Rhizoctonia solani) and classification of fungiJournal of Chemical Technology and Biotechnology2003786620625FarooqATaharaSChoudharyMIBiotransformation of (-)-α-pinene by Botrytis cinereaZeitschrift fur Naturforschung C2002573-4303306FarooqAChoudharyMITaharaSRahmanAUBaşerKHDemirciFThe microbial oxidation of (-)-β-pinene by Botrytis cinereaZeitschrift fur Naturforschung C2002577-8686690ZhangJZhangLWangXMicrobial transformation of 10-deacetyl-7-epitaxol and 1β- hydroxybaccatin I by fungi from the inner bark of Taxus yunnanensisJournal of Natural Products1998614497500ShibuyaHKitamuraCMaeharaSTransformation of Cinchona alkaloids into 1-N-oxide derivatives by endophytic Xylaria sp. isolated from Cinchona pubescensChemical and Pharmaceutical Bulletin20035117174SimanjuntakPPranaTKWulandariDDharmawanASumitroEHendriyantoMRChemical studies on a curcumin analogue produced by endophytic fungal transformationAsian Journal of Applied Sciences201036066BastosDZLPimentelICde JesusDAde OliveiraBHBiotransformation of betulinic and betulonic acids by fungiPhytochemistry200768683483917258248
Some structures obtained from endophytics microorganisms.
oai:pubmedcentral.nih.gov:30426362011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30426362135066410.4061/2011/632705Research ArticleCoexpression of PPE 34.9 Antigen of Mycobacterium avium subsp. Paratuberculosis with Murine Interferon Gamma in HeLa Cell Line and Study of Their Immunogenicity in Murine ModelDebRajib*GoswamiP. P.Division of Animal Biotechnology, Gene Expression Laboratory, Indian Veterinary Research Institute, Izatnagar, UP 243122, India*Rajib Deb: drrajibdeb@gmail.com
Mycobacterium avium subsp. paratuberculosis (Map) is the causative agent of johne's disease whose immunopathology mainly depends on cell mediated immuneresponse. Genome sequencing revealed various PPE (Proline-Proline-Glutamic acid) protein family of Map which are immunologically importance candidate genes In present study we have developed a bicistrionic construct pIR PPE/IFN containing a 34.9 kDa PPE protein (PPE 34.9) of Map along with a cytokine gene encoding murine gamma Interferon gene (IFNγ) and a monocistrionic construct pIR PPE using a mammalian vector system pIRES 6.1. The construct were transfected in HeLa cell line and expression were studied by Western blot as well as Immunefluroscent assay using recombinant sera. Further we have compared the immunereactivity of these two constructs in murine model by means of DTH study, LTT, NO assay and ELISA. DTH response was higher in pIR PPE/IFN than pIR PPE group of mice, similar finding also observed in case of LTT and NO production assay . ELISA titer of the pIR PPE/IFN was less than that with PPE only. These preliminary finding can revealed a CMI response of this PPE protein of Map and IFNγ having synergistic effect on this PPE protein to elicit a T cell based immunity in mice.
1. Introduction
Mycobacterium avium subsp. paratuberculosisis (MAP) is an intracellular pathogen, the causative organism of Johne's disease (paratuberculosis), a debilitating chronic enteritis in ruminants and has been implicated in Crohn's disease in humans characterised by hepatic granulomas in HIV-negative, nonimmunosuppressed patients [1]. This pathogen can multiply inside mononuclear phagocytes due to presence of various virulence determinants on their surface [2], and it is evident that cell-mediated immune response controls the resulting pathology.
The name PPE is derived from the motifs Pro-Pro-Glu, found in conserved domains near the N termini of these proteins having 180 amino acid sequences [3]. PPE proteins are thought to be expressed on the cell surface [4, 5] and have been found to be immunodominant antigens [6]. Some of the PPE proteins of Mycobacterium species have been reported to be potent T cell and or B cell antigens [7–14].
Although studies on various secretory proteins of mycobacterial species have shown that they are potential immunogens and can be used as subunit vaccine, using efficient immune adjuvants can enhance the performance of the DNA vaccine. Various cytokines especially IFNγ, IL-2, IL-6, IL-12, and IL-1 play a key role in immunity against mycobacterial infections [15] and have been shown to increase the protectivity while used for coimmunization with DNA vaccines. The essential task of IFNγ in the resistence of mice to mycobacterial infections has been make clear by reports that knockout of IFNγ gene from the mice cannot control or inhibit different mycobacterial infections [16]. Recently, a recombinant PPE protein, Map41, which has been reported as one of the IFN-γ-inducing antigens of MAP, also strongly induced IL-10 from macrophages obtained from infected calves [14].
Bicistronic vectors have been used to design DNA vaccine against HIV infection, which contained gp120 and GM-CSF gene [17], bicistronic DNA vaccine containing apical membrane antigen 1 and merozoite surface protein 4/5 can prime humoral and cellular immune responses and partially protect mice against virulent plasmodium chabaudi adami DS malaria [18], and a bicistronic woodchuck hepatitis virus core and gamma interferon DNA vaccine can protect from hepatitis [19]. Recently from our laboratory, Kadam et al. [20], have reported that coexpression of IFNγ with a 16.8 kDa gene of MAP can enhance immunogenicity of DNA vaccine using the same protein. In the present study, we have used a similar approach to clone a 34.9 kDa PPE (PPE34.9) antigen of MAP in the A frame of the bicistronic vector pIRES 6.1 having IFNγ gene in the frame B used by Kadam et al. [20]. Further, we have studied the coexpression of these two antigens in HeLa cell line. We have also preliminary attempted to elucidate the immunogenic effect of PPE 34.9 antigen of MAP on murine model and the role of IFNγ's adjuvant properties.
2. Materials and Methods2.1. Mycobacterial Strains
Solid and liquid cultures of MAP 316F were obtained from Central Diengenees Kunding Tieh Institute, Lelystad, the Netherlands and maintained at Biological Products Division of IVRI, Izatnagar, and later maintained at Gene Expression Laboratory, Division of Animal Biotechnology, IVRI, Izatnagar.
2.2. Plasmid Vectors and Host Strain Used
pTZ57R/T Cloning vector and host strain DH5α of E. coli were supplied by MBI Fermentas, Germany. Bicistronic vector pIRES 6.1 was supplied from Clontech, USA.
2.3. Laboratory Animals
Swiss albino mice and New Zealand white rabbits were obtained from Laboratory Animal Resource Section, IVRI, Izatnagar. Standard prescribed guidelines for care and use of laboratory animals were followed during the experimentation with these animals.
2.4. Culture and Growth of MAP
MAP organisms were grown on Middlebrook 7H10 agar enriched with 0.1% glycerol v/v and 10% OADC with additional supplementation of Mycobactin J (2 mg/L) and were maintained at 37°C.
2.5. Isolation of Genomic DNA Form MAP
The genomic DNA from MAP was isolated by following the published method [21].
2.6. Oligonucleotide Primers
A set of primers were designed for the specific amplification of the 1080 bp PPE34.9 gene of MAP based on the sequence information of MAP str.k10, complete genome Gene Bank Accession no. AE016958. Similarly, one set of primers was designed for the amplification of murine interferon gamma gene based on sequence information (Gene bank Accession no. NM_008337). The primers were synthesized by Integrated DNA Technologies, USA. The nucleotide sequences of these primers were as follows (Table 1).
2.7. Polymerase Chain Reaction and Amplification of PPE34.9 Gene Fragment
Specific amplification of the PPE gene from the genomic DNA of M. a. paratuberculosis was carried out using the above-mentioned primers pIRES MAP PPE F and pIRES MAP PPE R. The PCR was carried out in 25 μL reaction volume using 1 μL of genomic DNA (10 ng) as template, 2.5 μL of PCR buffer, 1 μL of MgCl2 (1.5 mM), 1 μL (25 μM) of each primers, 1 μL of dNTP mix (200 μM of each dNTP), and 1 U of Taq DNA polymerase. The volume was made up to 25 μL by adding DNase-free water. The thermal cycling steps were carried out in PTC-200 thermocycler MJ Research Inc., USA with initial denaturation at 94°C for 5 min followed by 30 cycles with denaturation at 94°C for 1 min, annealing at 55.0°C for 1 min, extension at 72°C for 30 seconds, and final extension at 72°C for 10 min. Size of the amplified product was confirmed by using DNA molecular weight marker in a 1% agarose gel and quantified by spectrophotometric analysis.
2.8. Cloning of PPE34.9 Gene of MAP in pTZ57R/T Cloning Vector
2 μL (100 ng) of eluted PCR product, 1 μL of pTZ57R/T (55 ng), 2 μL of 5X ligation buffer, 1 μL of T4 DNA ligase (5 units) were mixed in a sterile microcentrifuge tube and the volume was made up to 10 μL with nuclease free water. The ligation mixture was kept at 22°C overnight and stored at −20°C. Competent E. coli DH5α cells were prepared and transformed with 10 μL of ligation mixture as stated above. The transformed cells were spread on LB agar plate containing ampicillin (100 μg/mL), X-GAL (25 μg/mL) and IPTG (25 μg/mL). Appropriate positive and negative controls were processed simultaneously. Plates were incubated at 37°C overnight and later stored at 4°C. Ten white colonies were picked up and grown in LB broth containing ampicillin and incubated at 37°C overnight in a shaker incubator at 180 rpm. Plasmid DNA was extracted by miniprep plasmid isolation method [22]. Identification of positive colonies was done by Colony PCR and subsequently confirmed by RE analysis and designated as pTZ PPE.
2.9. Cloning of PPE Gene of MAP in a Mammalian Bicistronic Expression Vector pIRES and Plasmid Construct pIR IFN
The insert from the positive clone pTZ PPE (containing the appropriate restriction sites NheI and EcoRI specific for frame A of pIRES vector) was released by digesting with the enzymes Nhe I and EcoRI. The digested product was then ligated in the frame A after digestion of the vector with Nhe I and EcoRI to prepare monocistronic construct pIR PPE. The ligation mixture was transformed in E. coli competent DH5α cells. Further, to prepare bicistronic construct pIR PPE/IFN, pIR IFN [20] was used and same strategy was adapted to insert the PPE 34.9 in the frame A.
2.10. Preparation of Transfection Grade Plasmid
Large scale purification of the plasmid constructs pIR PPE and pIR PPE/IFN was done using endotoxin-free QIAGEN mega kit according to the manufacturer's instructions (Qiagen, Inc., Valencia, California).
2.11. Transfection of Plasmid Constructs in HeLa Cell line
The purified recombinant plasmids pIR PPE and pIR PPE/IFN were transfected to 60–70% confluent HeLa cells using SuperFect transfection reagent kit, following manufacturer's instructions (QIAGEN, Germany). Briefly, HeLa cell monolayer was subcultured and the cells were seeded in 25 cm2 tissue culture flask. When 60–70% monolayer was achieved, the cells were used for transfection. 5 μg of each DNA in 20 μL TE (pH 7.5) was diluted separately in optiMEM. Then 30 μL of superfect transfection reagent was added to the DNA solution. Afterwards, growth medium was aspirated from the dish and cells were washed with two mL DMEM (without serum and antibiotic). Then, 0.8 mL of the same DMEM were added to the reaction tube containing the transfection complexes and mixed properly. The mixtures thus prepared were layered separately over the cells and incubated for 6 hrs at 37°C followed by addition of DMEM with 10% FCS, and incubation was continued in a humidified CO2 incubator. Cells transfected with the respective plasmid constructs were harvested after 72 hrs of incubation by adding about 80 μL of 2X SDS-PAGE loading buffer, and the expressed proteins were resolved on SDSPAGE and western blotting using hyperimmune sera raised in rabbit against recombinant PPE 34.9 protein (1 : 200 in PBS).
2.12. RT-PCR (Reverse Transcription Polymerase Chain Reaction) for Conformation of Expression of IFN
One mL of trizol was layered on the transfected monolayer and the cells were lysed. Total RNA was isolated from the cells and amplified by RT-PCR. The amplified product was checked on 1.5% agarose. One mL trizol was added on the transfected monolayer and homogenized by passing the lysate 10 times through a sterile 20 G needle fitted to a syringe and transferred to a sterile 1.5 mL eppendorf. Further, the sample was kept at room temperature for five minutes. 200 μL of chloroform was added to the sample and mixed by vortexing. It was allowed to stand at room temperature for 10 minutes. The sample was then centrifuged at 12000 rpm for 20 minutes. The aqueous phase was collected in a separate vial to which 500 μL of isopropanol was added, mixed gently, and kept at room temperature. RNA pallet was washed with 500 μL 70% ethanol and dissolved in nuclease-free water. The yield of total RNA was determined spectrophotometrically using the formula
OD26O×33×200×10−3=μg/μL.
RT-PCR was carried out using RT PCR kit (MBI Fermentas, Germany). In a sterile microfuge tube, 2 μg of total RNA from pIR PPE/IFN were carried out to which 1 μL of random hexamer primer was added and incubated at 70°C for 5 min. Then, mixture, 1 μL RNase inhibitor, 2 μL of DNTP, and 4 μL of 5x RT buffer were added and tube was incubated at 37°C for 5 min. Thereafter, 1 μL of m MLV reverse transcriptase was added and the volume was made up to 20 μL by adding nuclease free water. The sample was incubated at 42°C for 1 hr, followed by incubation at 72°C for 10 min. The cDNA was stored at −20°C, until used. Amplification of IFNγ specific fragment from the cDNA preparation was prepared containing 4 μL of the cDNA sample, 2.5 μL of 10x PCR buffer, 200 μM of each Dntp, and 50 pMol each primers IFNpIR F and IFNpIR R. IFNγ amplification mixture was subjected to 30 cycles of denaturation (94°C, 1 min), annealing (55°C, 45 sec), and extension (72°C, 1 min) with a further final cycle for primer extension (72°C, 5 min).
2.13. Indirect Immunofluorescence Assay (IFA)
HeLa cells were seeded in 24 well plates and when a 60–70% confluent monolayer was achieved, two wells each were transfected with pIR PPE, pIR PPE/IFN, and pIRES (mock) plasmid. After incubation for 72 hr the medium was aspirated from all the wells, and the cells were permeabilized by adding 250 μL of 80% acetone for 30 min. Then, acetone was aspirated and the plate was dried at RT for 1 hr. Blocking was done using 1% BSA for 2 h at 37°C. Primary antibody (hyperimmune sera) was added at 1 : 50 dilution and kept for one hr at 37°C. This was followed by three gentle washes with PBS. FITC-labeled antirabbit conjugate was added at 1 : 200 dilution and kept for 1 hr at 37°C followed by washing with PBS and mounted in 50% PBS-glycerol. Cells were examined under fluorescent microscope.
2.14. Immunization of Animals with Plasmid Constructs
Swiss albino mice supplied by Laboratory Animal Section, IVRI, Izatnagar were maintained on ration comprising wheat dalia 62%, maize 30%, wheat bran 7%, salt 1%, and mineral mixture 25 ppm with 5 mL milk per mouse. The animals were divided into four groups, namely, A, B, C, and D each containing ten mice. They were vaccinated with the purified recombinant plasmid as shown in the Table 2.
Mice (three numbers) from each group were bled on the 21st and the 42nd days for serum separation which were stored at −20°C and used in the determination of antibody titres by ELISA.
2.15. Collection of Macrophages and Splenocytes from Plasmid-Immunized mice
On the 42nd day after immunization of mice, four mice from each group were selected randomly. About 5 mL of sterile RPMI 1640 medium were injected into the peritoneal cavity of each mouse, gently massaged, and the mice were left in the cage for 5 min. Then, the mice were sacrificed by CO2 asphyxiation, and the peritoneal fluid was aspirated. The macrophages in the aspirated fluid were collected by centrifugation and resuspension of the obtained pellet in RPMI 1640 medium and subsequently used for nitric oxide (NO) estimation. After aspiration of peritoneal fluid, abdominal cavity was cut open. Spleens were harvested from sacrificed mice and made into a single cell suspension. The cells suspended in RPMI-1640 were layered over Ficoll-Paque PLUS, and mononuclear splenocytes were isolated by density gradient centrifugation at 1350 × g for 30 min. Splenocytes thus obtained were used for LTT and RNA isolation.
2.16. Measurement of DTH Reaction
Six mice from each group were selected for DTH study. On the 42nd day after first immunization. All the mice were injected intradermally with 10 μg of johnin in right hind foot pad and 10 μg of purified PPE 34.9 recombinant protein in the left hind foot pad. The results of the local skin reactions (DTH) were observed after 48 h by measuring the two transverse diameters of erythema using Vernier calipers with a minimum measurable increment of 0.01 mm. Data was statistically analyzed using Students' t-test at a significant level of P < .05.
2.17. Lymphocyte Transformation Test (LTT)
The mononuclear splenocytes (5 × 105 cells per well) from four mice were placed in 96 well plates (Nunc, Denmark) in complete RPMI-1640 (phenol red free) medium containing 10% heat-inactivated foetal calf serum, 2 mM L-glutamine, 100 U of penicillin, and 100 mg streptomycin per ml. Respective Ni NTA column-purified recombinant PPE 34.9 [23] and ConA (positive control) were added at the final concentration of 40 μg/mL and 10 μg/ml, respectively. RPMI was used as the negative control. The total volume per well was 200 μL. The plates were kept in a humidified CO2 incubator at 37°C for 72 h. At the end of the incubation, 20 μL of the yellow tetrazolium salt MTT (5 mg/mL) were added and incubated at 37°C for 4 h. In the presence of living cells, MTT is transformed to purple formazan [24]. Subsequently, 100 μL of 0.04 N HCl in isopropanol were added and allowed to react for 30 min to stop the colour development reaction and dissolve the formazan crystals. The absorbance (OD) of the samples was measured in an ELISA reader at 570 nm (and 650 nm as reference) wavelength. Assays were conducted in triplicates, and the results expressed as Mean ± SE. Stimulation index (SI) was calculated using the formula SI = OD of stimulated culture ÷ OD of unstimulated culture. SI value of >1.2 (i.e., 33% more than the control) was considered for lymphocyte proliferation. Data was analysed for significance between mock pIR and pIR PPE as well as pIR PPE and pIR PPE/IFN constructs by Student's t-test, and differences with P < .05 were considered within the level of significant.
2.18. NO Production Assay
The RPMI 1640 complete medium was supplemented with 5 mM of L-arginine for this assay. 100 μL of the cell suspension containing 2 × 105 peritoneal macrophages from four mice from each group were plated in triplicate in 96 well plates. Respective antigen Ni NTA column-purified recombinant PPE 34.9 [23] and LPS (positive control) in RPMI 1640 medium (100 μL) were added at the final concentration of 40 μg/mL and 2 μg/mL, respectively. RPMI was used as the negative control. The total volume per well was 200 μL. The plates were incubated at 37°C in a humidified CO2 (5%) incubator for 48h. Supernatants were collected from all the wells and stored at −20°C until NO estimation. For NO estimation NaNO2 (sodium nitrite) in different concentrations was used as standard. In a 96-well ELISA plate to 50 μl of the cell culture supernatant or standard, 60 μL of Griess reagent (1% sulfanilamide in 1.2 N HCl) (Sigma) was added, and the plates were incubated at 37°C for 30 min, A550 reading was taken on a microplate ELISA reader. By using the standard curve (NaNO2 concentration versus A550) the NO levels in the samples were estimated. Data was analysed by Student's t-test, and differences with P < .05 were considered significant.
2.19. Characterization of PPE Specific Antibodies in Mice Groups Immunized with Plasmid Constructs by ELISA
The optimum concentration of Ni NTA column-purified recombinant PPE 34.9 [23] antigen and conjugate were determined using block titration as described by Engwal and Pearlman [25]. The wells of ELISA plates (Nunc, Denmark) were coated with 200 ng/well of antigen diluted in carbonate bicarbonate buffer, and the plates were incubated at 4°C overnight. The plates were washed thrice with PBS-Tween 20 (PBS-T) and blocked with 5% skim milk powder in PBS-T for 2 h at 37°C. Then, 1 : 200 dilution of serum in 100μL volume of PBS-T were added in duplicate and incubated at 37°C for one hour. The plates were washed thrice with PBS-T for 3 min at each wash. Conjugate antimouse IgG HRPO at dilution of 1 : 10,000 in 100 μL volume was added to each well, and the plates were incubated for 1hr at 37°C. The plates were then washed three times with PBS-T, and colour was developed with 100 μL of 10 mg/mL OPD with 10 μL of 30% H2O2 in substrate buffer. After sufficient colour development, the reaction was stopped by the addition of 50 μL 1N H2SO4, and the plates were read at 490 nm in an ELISA reader (Tecan, Austria).
3. Results3.1. Construction and Characterization of Plasmids pIR PPE and pIR PPE/IFN
The bicistronic constructs were generated after cloning PPE34.9 gene fragment from Nhe I and Eco RI digested PCR product into frame A of Nhe I and Eco RI digested plasmid vector and Xba I- Not I digested IFNγ into frame B of the same vector. The positive colonies from the construct was identified by obtaining desired size products using colony PCR and subsequently confirmed by the release of identical size inserts on RE analysis (Figure 1). The plasmid constructs (monocistronic and bicistronic) were transfected into 60–70% confluent HeLa cell line, and the expressed PPE34.9 protein was detected from 72-hour posttransfected cell lysate in western blot using polyclonal serum raised in rabbit against recombinant PPE34.9. No such band was observed in cell lysate transfected with mock plasmid (Figure 2). The 72-hour posttransfected HeLa cells with plasmid constructs pIR PPE and pIR PPE/IFN on IFA using FITC-labeled conjugate exhibited fluorescence under fluorescent microscope, indicating the expression of the PPE34.9 protein (Figures 3(a), 3(b), 3(c), and 3(d)).The monoclonal antibodies against murine IFNγ could bind with HeLa cell expressed IFN protein to reconfirm IFNγ expression from the construct pIRPPE/IFN, RT-PCR was done for the cDNA obtained from total RNA of a 72-hour posttransfected HeLa cell lysate using specific primers of murine IFNγ. At 55°C, annealing temperature gave the amplified product of 467 bp (Figure 4).
3.2. Induction of DTH Response
DTH response was measured with Vernier Calipers 72 hrs after injection of PPE34.9 protein in the foot pad of Plasmid-immunized groups of mice. Skin reactions to recombinant PPE34.9 protein was studied. Both the control groups showed no significant reaction to antigen. Mice group immunized with pIR PPE and pIR PPE/IFN evoked visible skin reactions in the form of necrosis and erythema. However, more significant (3.115 ± 0.005) erythematous lesions were observed in mice immunized with pIR PPE/IFN in comparison to pIR PPE-immunized groups (2.516 ± 0.132). Whereas, mice immunized with plasmid pIRES (mock) showed no significant swelling when compared to the injection of PBS (Table 3). Statistical analysis with Student's t-test showed significant difference (P < .05) between pIR PPE/IFN and pIR PPE alone.
3.3. LTT-Based In Vitro Lymphocyte Proliferation Test
The purified recombinant PPE34.9 protein stimulated a significant proliferation of mononuclear splenocytes from mice groups immunized with constructs pIR PPE and pIR PPE/IFN. Higher proliferation was obtained with construct pIR PPE/IFN (1.38 ± 0.079) followed by group pIR PPE (1.21 ± 0.076) upon stimulation with purified PPE34.9 protein. (Table 4). Statistical analysis with student's t-test showed significant difference (P < .05) between pIR (mock) and pIR PPE as well as pIR PPE and pIR PPE/IFN groups.
3.4. NO Production Assay
Peritoneal macrophages collected from various mice groups were stimulated with the respective antigens to measure the amount of nitric oxide produced by the cells. The quantity of NO produced was estimated by comparing with known standards of sodium nitrite. LPS induced significant production of NO in all the groups. Among the immunized groups, NO production was found highest in group pIR PPE/IFN (Mean ± SEM = 38.62 ± 1.02 μm/2 × 105 cells) followed by group pIR PPE (Mean ± SEM = 26.19 ± 0.53 μm/2 × 105 cells) upon stimulation with recombinant PPE34.9 protein. (Table 5). Statistical analysis with student's t-test showed significant difference (P < .05) between pIR (mock) and pIR PPE as well as pIR PPE and pIR PPE/IFN groups.
3.5. Detection of Immune Response Induced by Various Plasmids Constructs in Mice by ELISA
To evaluate the humoral immune response induced by plasmid constructs in mice groups, on the 21st day and the 42nd day postimmunization antibody titres were determined by indirect ELISA. Antibodies were detected in all the plasmid constructs immunized groups of mice (OD490 > 0.3 in the serum dilution range of 1 : 200). Whereas, insignificant titres were observed in control groups (Table 6).
4. Discussion
Presently, chemotherapy is unrewarding and economically not feasible to control the diseases. Effective control programmes for the disease are hampered due to lack of specific diagnostic tests to detect infection in the early stages of disease. Further the currently available immunodiagnostic tests have limited sensitivity [26] and specificity [27].
Conventional live attenuated vaccines are not completely protective [28, 29]. Studies have shown that CMI develops in early stages for clearing infection [30] whereas high serum antibody concentration is often seen in advanced clinical cases [31]. The cell-mediated immunity plays a pivotal role to control the spread of organisms within the host body [32]. DNA vaccines may open new horizons for effective vaccination against paratuberculosis as strong CMI responses including CTL and Th1 type cytokines are induced [20].
Expressions of T cell antigens in prokaryotic vector have failed to induce CTL and cytokine response. However, expression of T cell antigen in a mammalian vector for eliciting CD4+ T cell response and CD8+ cytotoxic T cell response to generate immunity have been reported in a number of animal models [33–36]. Cytokines also (mainly IFNγ, TNFα, IL10 etc.) play a major role in the protective immune response against mycobacterial diseases [14, 32]. Coexpression of T cell antigen with costimulatory molecules in a bicistronic eukaryotic system made the DNA vaccine more effective [17–20]. Moreover, expression of two T cell antigens in eukaryotic bicistronic system may also be useful for enhancing protective immunity.
After the completion of the genome sequencing of MAP, the PPE protein family has been widely assumed to represent immunologically important antigens of the mycobacterial species. The present work envisaged keeping in view the role of a PPE antigen and the concept of bicistronic DNA constructs using an immunostimulatory molecule IFNγ is likely to potentiate immune response in mice. The use of cytokines as adjuvant is known to enhance immune responses when they were administered during the development of immune response against a particular antigen [37, 38]. IFNγ is the most extensively studied cytokine in mycobacterial infections. It is the defining cytokine of Th1 subset and activates macrophages for microbicidal activity. It induces IL12, which causes Th cells to differentiate into Th1 subset [39].
In the present study, the gene fragment encoding PPE34.9 protein was cloned into the frame A of the bicistronic vector pIRES6.1 containing IFNγ gene in frame B and also a monocistronic plasmid construct pIR PPE was made. The constructs were designated as pIR PPE/IFN and pIR PPE, respectively. Bicistronic vector pIRES6.1 contained immediate early CMV promoter for simultaneous expression of the two genes downstream to it as active protein. Expression of the PPE34.9 and IFNγ. (17 kDa) proteins was confirmed by western blot and immunofluorescence assay in 72-hour posttransfected HeLa cell lysates using polyclonal sera. Size of mouse IFNγ. gene is 1208 bp in length but coding sequence is 467 bp, which was used for IFNγ. ORF expression. The results were in agreement with the eukaryotic bicistronic expression of 16.8 kDa antigen of MAP and murine IFNγ.in a bicistronic vector [20], a glycoprotein C of pseudorabies virus [40] and an apical membrane antigen and merozoite surface protein of Plasmodium chabaudi DS malaria [18].
In the present study, we have cloned and coexpressed a 34.9 kDa protein-encoding PPE gene family antigen with IFNγ gene in HeLa cell line. Further, we have studied the immune responses of these plasmid constructs in mice. Elucidation of DTH response against recombinant P35 proteins and 16.8 kDa proteins of MAP has been studied by and Basagoudanavar et al. [41] and Kadam et al. [20], respectively. DTH-based immune response is an indicator of T-cell-based immunity. We have already elucidated the DTH response of purified recombinant PPE 34.9 proteinin mice [23]. In the present study we have compare the effect of IFN as pIR PPE/IFN construct on PPE 34.9 as pIR PPE construct, which showed that a significant higher immune response of the first construct on the second one indicate the role of IFNγ to elicit a T cell based immune response.
Cell proliferation as a test has been used to assess DNA vaccines against mycobacterial infections [20, 41]. In the present study, mononuclear splenocytes from mice group immunized with pIR PPE/IFN showed higher cell proliferation than pIR PPE, which may indicate the effect of IFNγ. IL2 is known as the cytokine for cell proliferation, but IFNγ indirectly induces cell proliferation by activating macrophages and increasing antigen presentation which induces IL2 receptors on T cell surface, thereby inducing cell proliferation. The results were in consensus as found by other workers who used cytokines as immunoadjuvant in bicistronic DNA vaccine. Chow et al. [42] have reported increased cell proliferation in group that received hepatitis B virus surface protein and IL2 as bicistronic DNA vaccine. Barouch et al. [17] found twofold augmentation of cell proliferation in bicistronic group which coexpressed gp120 gene of HIV and GMCSF than in monocistronic gp120 immunized group. Kadam et al. [20], also found that bicistronic vector expressing a 16.8 kDa protein of MAP along with IFNγ gene induce higher proliferative response than the protein alone.
It is known that RNI r nitrogen intermediates), especially nitric oxide (NO), are most effective in direct killing of mycobacteria [15]. An increased production of NO-induced vaccine candidate genes may be one of the important causes of effective immune response against mycobacterial infection. As in our present study, NO production from cells of pIR PPE/IFN group was comparatively higher than PPE34.9 alone, it may again indicate the role of IFNγ in the induction/stimulation of macrophages to release RNI (NO). Recombinant protein PPE 34.9 was purified using single-step Nickel-NTA (pQE 30 UA containing His tag vector was used) affinity column chromatography [23], chance of LPS/endotoxin contamination is negligible. The results were in consensus as found by other workers who reported that it plays an important role in release of NO from monocytes [20, 43].
ELISA adopted to study the humoral immune response following DNA vaccination in mice for 22kDa antigen of M. bovis [44] and MPT64, Ag85B, and ESAT-6 [45] antigens of M. tuberculosis showed significant increase in log titre of circulating antibodies. In the present study, antibody titer of the construct pIR PPE/IFN was less than that with PPE34.9 only. It may be possible that here IFN down regulating the IgG mediate humoral immunity induced by PPE34.9 protein which needs to be further confirmed in large number of animals. This result may be correlated to the groups who find that codelivery of IFN-gamma or IL-4 encoding EG95 protein of Echinococcus granulosus, the causative agent of hydatid appeared to reduce the ability of the DNA vaccine to prime an IgG antibody response demonstrated the efficacy of the codelivery of cytokines to modulate immune responses generated in a DNA prime-protein boost strategy [46].
Overall, the preliminary findings possibly revealed that the PPE34.9 antigen of MAP may be a T-cell-based immunogen. This is in agreement with the studies reported on PE antigen of M. avium by Parra et al. [47], antigen induced both cell-mediated [48] and humoral immune responses [49] which again was in corroboration with the earlier works.
Immune adjuvants plays an important role to enhance the protective efficacy of DNA vaccines [50]. IFNγ is a potent activator of macrophages and is the key cytokine in Th1-type immune response in paratuberculosis infection produced by both CD4+ and CD8+ cells [20, 51]. Hence for the development of an effective measure against paratuberculosis, it is necessary to apply those strategies that should enhance the T cell mediate response. From our preliminary observations, we have also noticed that the monocistronic construct pIR PPE elicited a comparatively milder CMI response than pIR PPE/IFN. This may revealed that the presence of IFNγ synergized the T cell response of PPE34.9 protein.
These preliminary observations need further confirmation like in vitro study of the Th1 cytokine mediate response of the PPE34.9 and challenge studies in experimental as well as natural hosts for the development of an effective bicistronic DNA vaccine against paratuberculosis infection.
Acknowledgment
The authors are thankful to the Director of IVRI, Izatnagar for providing the necessary facilities to conduct the present study.
ToyodaMYokomoriHKanekoFHepatic granulomas as primary presentation of Mycobacterium avium infection in an HIV-negative, nonimmunosuppressed patientClinical Journal of Gastroenterology200926431437LiYJDanelishviliLWagnerDPetrofskyMBermudezLEIdentification of virulence determinants of Mycobacterium avium that impact on the ability to resist host killing mechanismsJournal of Medical Microbiology201059181619745033Gey Van PittiusNCSampsonSLLeeHKimYVan HeldenPDWarrenRMEvolution and expansion of the Mycobacterium tuberculosis PE and PPE multigene families and their association with the duplication of the ESAT-6 (esx) gene cluster regionsBMC Evolutionary Biology20066, article 95BrennanMJDeloguGChenYEvidence that mycobacterial PE_PGRS proteins are cell surface constituents that influence interactions with other cellsInfection and Immunity200169127326733311705904DeloguGPuscedduCBuaAFaddaGBrennanMJZanettiSRv1818c-encoded PE_PGRS protein of Mycobacterium tuberculosis is surface exposed and influences bacterial cell structureMolecular Microbiology200452372573315101979ChoudharyRKMukhopadhyaySChakhaiyarPPPE Antigen Rv2430c of Mycobacterium tuberculosis Induces a Strong B-Cell ResponseInfection and Immunity200371116338634314573653OkkelsLMBrockIFollmannFPPPE protein (Rv3873) from DNA segment RD1 of Mycobacterium tuberculosis: strong recognition of both specific T-cell epitopes and epitopes conserved within the PPE familyInfection and Immunity200371116116612314573626HuntleyJFStabelJRPaustianMLReinhardtTABannantineJPExpression library immunization confers protection against Mycobacterium avium subsp. paratuberculosis infectionInfection and Immunity200573106877688416177367MarriPRBannantineJPGoldingGBComparative genomics of metabolic pathways in Mycobacterium species: gene duplication, gene decay and lateral gene transferFEMS Microbiology Reviews200630690692517064286NewtonVMc KennaSLDe BuckJPresence of PPE proteins in Mycobacterium avium subsp. Paratuberculosis isolates and their immunogenecity in cattleVeterinary Microbiology200913539440019004580BertholetSIretonGCKahnMIdentification of human T cell antigens for the development of vaccines against Mycobacterium tuberculosisJournal of Immunology20081811179487957NairSRamaswamyPAGhoshSThe PPE18 of Mycobacterium tuberculosis interacts with TLR2 and activates IL-10 induction in macrophageJournal of Immunology20091831062696281GoldstoneRMGoonesekeraSDBloomBRSampsonSLThe transcriptional regulator Rv0485 modulates the expression of a pe and ppe gene pair and is required for Mycobacterium tuberculosis virulenceInfection and Immunity200977104654466719651861NagataRKawajiSMinakawaYWangXYanakaTMoriYA specific induction of interleukin-10 by the Map41 recombinant PPE antigen of Mycobacterium avium subsp. paratuberculosisVeterinary Immunology and Immunopathology20101351-2717820018382MulleradJHovavAHNaharyRFishmanYBercovierHImmunogenicity of a 16.7 kDa Mycobacterium paratuberculosis antigenMicrobial Pathogenesis2003342819012623276AdamsJLCollinsMTCzuprynskiCJPolymerase chain reaction analysis of TNF-α and IL-6 mRNA levels in whole blood from cattle naturally or experimentally infected with Mycobacterium paratuberculosisCanadian Journal of Veterinary Research19966042572628904661BarouchDHSantraSTenner-RaczKPotent CD4+ T cell responses elicited by a bicistronic HIV-1 DNA vaccine expressing gp120 and GM-CSFJournal of Immunology20021682562568RainczukAScorzaTSpithillTWSmookerPMA bicistronic DNA vaccine containing apical membrane antigen 1 and merozoite surface protein 4/5 can prime humoral and cellular immune responses and partially protect mice against virulent Plasmodium chabaudi adami DS malariaInfection and Immunity200472105565557315385453WangJGujarSACovaLMichalakTIBicistronic woodchuck hepatitis virus core and gamma interferon DNA vaccine can protect from hepatitis but does not elicit sterilizing antiviral immunityJournal of Virology200781290391617079319KadamMShardulSBhagathJLTiwariVPrasadNGoswamiPPCoexpression of 16.8 kDa antigen of Mycobacterium avium paratuberculosis and murine gamma interferon in a bicistronic vector and studies on its potential as DNA vaccineVeterinary Research Communications200933759761019199070DertzbaughMTGenetically engineered vaccines: an overviewPlasmid19983921001139514708SambrookJRusselDWMolecular Cloning: A Laboratory Manual20013 editionCold spring Harbor, NY, USACold Spring Harbor Laboratory PressDebRGoswamiPPExpression of a Gene Encoding 34.9 kDa PPE Antigen of Mycobacterium avium subsp. paratuberculosis in E. coliMolecular Biology International201020107 pagesArticle ID 628153.MossMTGreenEPTizardMLSpecific detection of Mycobacterium paratuberculosis by DNA hybridization with a fragment of the insertion element IS900Gut1991323953981851124EngwalEPearlmanPEnzyme linked immunosorbent (ELISA), qualitative assay of immunoglobulin G Immunochemistry1971898718745135623HopeAFKluverPFJonesSLCondronRJSensitivity and specificity of two serological tests for the detection of ovine paratuberculosisAustralian Veterinary Journal2000781285085611194475OlsenIWikerHGJohnsonELangeggenHReitanLJElevated antibody responses in patients with Crohn’s disease against a 14-kDa secreted protein purified from Mycobacterium avium subsp. paratuberculosisScandinavian Journal of Immunology200153219820311169225HarrisNBBarlettaRGMycobacterium avium subsp. paratuberculosis in Veterinary MedicineClinical Microbiology Reviews200114348951211432810FlynnJLImmunology of tuberculosis and implications in vaccine developmentTuberculosis2004841-29310114670350SweeneyRWJonesDEHabeckerPScottPInterferon-γ and interleukin 4 gene expression in cows infected with Mycobacterium paratuberculosisAmerican Journal of Veterinary Research19985978428479659548StabelJRCytokine secretion by peripheral blood mononuclear cells from cows infected with Mycobacterium paratuberculosisAmerican Journal of Veterinary Research200061775476010895895CoussensPMVermanNCoussensMAElftmanMDMcNultyAMCytokine gene expression in peripheral blood mononuclear cells and tissue of cattlenfected with Mycobacterium avium subsp. paratuberculosis : evidence for an inherent proinflammatory gene expression patternInfection and Immunity20047231409142214977946MartinEKamathATTriccasJABrittonWJProtection against virulent Mycobacterium avium infection following DNA vaccination with the 35-kilodalton antigen is accompanied by induction of gamma interferon-secreting CD4+ T cellsInfection and Immunity20006863090309610816448ChambersMAWilliamsAHatchGVaccination of guinea pigs with DNA encoding the mycobacterial antigen MPB83 influences pulmonary pathology but not hematogenous spread following aerogenic infection with Mycobacterium bovisInfection and Immunity20027042159216511895982PardiniMGiannoniFPalmaCImmune response and protection by DNA vaccines expressing antigen 85B of Mycobacterium tuberculosisFEMS Microbiology Letters2006262221021516923077SechiLAMaraLCappaiPImmunization with DNA vaccines encoding different mycobacterial antigens elicits a Th1 type immune response in lambs and protects against Mycobacterium avium subspecies paratuberculosis infectionVaccine200624322923516183174AndersenPTB vaccines: progress and problemsTrends in Immunology200122316016811286732KaufmannSHEHow can immunology contribute to the control of tuberculosis?Nature Reviews Immunology2001112030GoldsbyRAKindtTJOsborneBAKubyJImmunology20035th editionNew York, Ny, USAW.H. Freeman and Company, New York PressXiaoSChenHFangLComparison of immune responses and protective efficacy of suicidal DNA vaccine and conventional DNA vaccine encoding glycoprotein C of pseudorabies virus in miceVaccine2004223-434535114670315BasagoudanavarSHGoswamiPPTiwariVCellular immune responses to 35 kDa recombinant antigen of mycobacterium avium paratuberculosisVeterinary Research Communications200630435736716502104ChowYHHuangWLChiWKChuYIDTaoMIHImprovement of Hepatitis B Virus DNA Vaccines by Plasmids Coexpressing Hepatitis B Surface Antigen and Interleukm-2Journal of Virology19977111691788985336ZhuXVenkataprasadNThangarajHSFunctions and Specificity of T Cells Following Nucleic Acid Vaccination of Mice Against Mycobacterium tuberculosis InfectionJournal of Immunology19971581259215926LefèvrePDenisODe WitLCloning of the gene encoding a 22-kilodalton cell surface antigen of Mycobacterium bovis BCG and analysis of its potential for DNA vaccination against tuberculosisInfection and Immunity20006831040104710678905KamathATHankeTBriscoeHBrittonWJCo-immunization with DNA vaccines expressing granulocyte-macrophage colony-stimulating factor and mycobacterial secreted proteins enhances T- cell immunity, but not protective efficacy against Mycobacterium tuberculosisImmunology199996451151610233735ScheerlinckJPYCaseyGMcWatersPThe immune response to a DNA vaccine can be modulated by co-delivery of cytokine genes using a DNA prime-protein boost strategyVaccine20011928-294053406011427282ParraMCadieuxNPickettTDheenadhayalanVBrennanMJA PE protein expressed by Mycobacterium avium is an effective T-cell immunogenInfection and Immunity200674178678916369041BasagoudanavarSHGoswamiPPTiwariVPandeyAKSinghNHeterologous expression of a gene encoding a 35 kDa protein of Mycobacterium avium paratuberculosis in Escherichia coliVeterinary Research Communications200428320922415074767ShinSJYooHSMcDonoughSPChangYFComparative antibody response of five recombinant antigens in related to bacterial shedding levels and development of serological diagnosis based on 35 kDa antigen for Mycobacterium avium subsp. paratuberculosisJournal of Veterinary Science20045211111715192337KathaperumalKKumananVMcDonoughSEvaluation of immune responses and protective efficacy in a goat model following immunization with a coctail of recombinant antigens and a polyprotein of Mycobacterium avium subsp. paratuberculosisVaccine200927112313518955101FlynnJLChanJImmunology of tuberculosisAnnual Review of Immunology20011993129
Agarose gel electrophoresis (1%) of the cloned fragment of the gene encoding PPE protein in pIRES IFN PPE mammalian vector. Lane M1: DNA molecular weight marker Lamda DNA/EcoRI/Hind III. Lane 1: pIRES IFN PPE linearised with EcoRI. Lane 2: released insert of 1080 bp after NheI and EcoRI digestion of recombinant pIRES IFN PPE recombinant plasmid DNA. Lane 3: PCR amplified fragment encoding PPE protein of Mycobacterium avium subsp. paratuberculosis. Lane 4: pIR IFN linearised with Xba I. Lane 5: release IFN fragment (467 bp) by digestion with Xba I and Not I from pIR IFN vector DNA. Lane 6: release IFN fragment (467 bp) by digestion with Xba I and Not I from pIR IFN PPE vector DNA. Lane 7: PCR amplified fragment of IFN (467 bp). Lane M2: DNA molecular weight marker pUC18/Sau3AI-pUC18/TaqI digest.
Western blot assay of 72-hour culture of HeLa cell transfected with pIRPPE and pIRPPE/IFN showing expressed 34.9 kDa PPE protein. Lane M: prestained protein molecular weight marker. Lane 1: whole cell lysate of HeLa cell transfected with pIRES (mock control). Lane 2: whole cell lysate of HeLa cell transfected with pIRES PPE. Lane 3: whole cell lysate of HeLa cell transfected with pIRES PPE/IFN.
(a) Healthy HeLa cells (untransfected). (b) HeLa cells transfected with pIRES mock control. (c) HeLa cells transfected with pIRES PPE vector construct showing expression of PPE protein using o polyclonal sera raised in rabbit against PPE 34.9 react with FITC-labeled antirabbit conjugate. (d) HeLa cells transfected with pIRES PPE/IFN vector construct showing expression of PPE protein using o polyclonal sera raised in rabbit against PPE 34.9 react with FITC-labeled antirabbit conjugate.
Agarose gel electrophoresis (1.5%) showing RT-PCR based expression of IFNγ ORF in pIR PPE IFN transfected HeLa cells. Lane M: prestained protein molecular weight marker (100 bp ladder). Lane 1: negative control mock plasmid transfected HeLa cells. Lane 2: IFNγ encoding gene from pIR PPE IFN transfected HeLa cells with super natantγ. Lane 3: positive control (IFNγ) encoding gene from ConA induced mice splenocytes.
List of specific primers used for the present study.
Primers
Oligonucleotide sequences
pIRES MPPPE F(Sense)
5′GCC GCT AGC ATG TGG GTC CAG GCC GCC AC 3′-29 mers
5′CCG CGG CCG CTC AGC AGC GAC TCC TTT T 3′-28 mers
Mice Immunization schedules.
S. no.
Mice group
Plasmid construct used
First dose (0 day)
Booster dose (35th day)
1
A
TE buffer control
100 μg
100 μg
2
B
pIRES mock control
100 μg
100 μg
3
C
pIRESPPE
100 μg
100 μg
4
D
pIRESPPE /IFN
100 μg
100 μg
DTH responses in mice immunized with plasmid constructs expressed as mean differences (mm) upon recall with 10 microgram of PPE34.9.
Groups
PBS
PPE 34.9
Group A (TE buffer as control)
0.082 ± 0.001
0.235 ± 0.018
Group B pIRES (mock)
0.082 ± 0.0007
0.111 ± 0.011
Group C pIRES PPE
0.211 ± 0.007
2.516 ± 0.132
Group D pIRES PPE
0.215 ± 0.0104
3.115 ± 0.005
Lymphocyte transformation test for mice groups immunized with Plasmid constructs (SI = Mean ± SEM).
Groups
ConA
PPE protein
A (TE buffer control)
1.03 ± 0.05
0.96 ± 0.042
B (pIRES mock control)
1.04 ± 0116
0.97 ± 0.031
C (pIRESPPE)
1.3 ± 0.101
1.21 ± 0.076
D (pIRESPPE /IFN)
1.41± 0.17
1.38 ± 0.079
Nitric oxide production assay of peritoneal macrophages from mice groups immunized with Plasmid constructs (μm of NO/2 × 105 cells = Mean ± SEM).
Groups
LPS
PPE protein
A (TE buffer control)
29.32 ± 0.5042
7.85 ± 0.2933
B (pIRES mock control)
30.77 ± 0.6617
7.29 ± 0.3199
C (pIRESPPE)
33.43 ± 1.9381
26.19 ± 0.535
D (pIRESPPE /IFN)
40.89 ± 2.3452
38.62 ± 1.020
ELISA titres of plasmid construct-injected mice groups (OD490 = Mean ± SEM).
Groups
21st day
42nd day
Blank
0.031 ± 0.0035
0.044 ± 0.0034
A (TE buffer control)
0.131 ± 0.0076
0.136 ± 0.012
B (pIRES mock control)
0.142 ± 0.0371
0.156 ± 0.012
C (pIRESPPE)
0.312 ± 0.0204
0.322 ± 0.030
D (pIRESPPE /IFN)
0.263 ± 0.018
0.283 ± 0.021
oai:pubmedcentral.nih.gov:30426642011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30426642135066510.4061/2011/658493Research ArticleProduction and Optimization of Cellulase Enzyme Using Aspergillus niger USM AI 1 and Comparison with Trichoderma reesei via Solid State Fermentation SystemLeeC. K.1*DarahI.1IbrahimC. O.21Industrial Biotechnology Research Laboratory, School of Biological Sciences, Universiti Sains Malaysia, Minden,11800 Penang, Malaysia2Faculty of Agroindustry and Natural Resource, Universiti Malaysia Kelantan, Karung Berkunci 36, Pengkalan Chepa, 16100 Kelantan, Malaysia*C. K. Lee: cklee1311@yahoo.co.uk
Novel design solid state bioreactor, FERMSOSTAT, had been evaluated in cellulase production studies using local isolate Aspergillus niger USM AI 1 grown on sugarcane bagasse and palm kernel cake at 1 : 1 (w/w) ratio. Under optimised SSF conditions of 0.5 kg substrate; 70% (w/w) moisture content; 30°C; aeration at 4 L/h · g fermented substrate for 5 min and mixing at 0.5 rpm for 5 min, about 3.4 U/g of Filter paper activity (FPase) was obtained. At the same time, comparative studies of the enzymes production under the same SSF conditions indicated that FPase produced by A. niger USM AI 1 was about 35.3% higher compared to Trichoderma reesei. This shows that the performance of this newly designed SSF bioreactor is acceptable and potentially used as prototype for larger-scale bioreactor design.
1. Introduction
Malaysia spent a lot of money yearly on various types of enzymes for local industries use and research purposes. This was because no attempts have been made to produce the enzymes for commercial using local resources. Solid state fermentation (SSF), an alternative for submerged fermentation for enzyme production, was found to be more favorable, which can be performed under limited financial and labour requirements. Agroindustrial residuals have potentially been used as substrate in SSF not only for enzymes production but also other secondary metabolites. In this aspect, countries like Malaysia with abundant agro-industrial residual especially oil palm industry, will be at great advantage.
In addition, many research activities focused on SSF, which had lead to a wide range of applications not only at laboratory scale [1–5] but also at pilot and industrial scale [6–9]. In fermentation, bioreactor provides control environment for growth and activity of the microorganism that carried out biological reactions [10]. On the other hand, selection of an appropriate type of bioreactor is also crucial since bioreactor is the “heart” of the fermentation process. Furthermore, there are many types of SSF bioreactors and all their performances are different [11].
This study was to produce cellulase enzyme using Aspergillus niger USM AI 1 grown on sugar cane bagasse and palm kernel cake (PKC). The major factors that affect the SSF process for enzyme production have been investigated. These included amount of substrate, moisture content, aeration rate and time, mixing rate, and mixing intensity. At the same time, comparative studies with Trichoderma reesei have been carried out.
2. Materials and Methods2.1. Microorganism
Aspergillus niger USM AI 1 was used throughout this study for the production of cellulase. It was obtained from Industrial Biotechnology Research Laboratory (IBRL) culture collection, USM Penang. It is a local isolate, which was obtained from the Northern Region of Peninsular Malaysia in year 2002. Trichoderma reseei, which is an established culture for cellulase production was used as a benchmark for the production of cellulase by A. niger USM AI 1. In order to compare the enzymes production, the determined optimum SSF conditions were used by T. reseei on the production of cellulase.
2.2. Solid State Fermentation Condition 2.2.1. Fungus Cultivation for Spore Production and Inoculum Preparation
Fungus spore was obtained by growing the culture on Potato Dextrose Agar (AES, France) under room temperature in medium bottles. The spore was harvested after 4-5 days of cultivation with sterile distilled water containing 0.1% (w/v) Tween 80 [12]. The spore suspension was passed through a 0.5 mm sieve to eliminate mycelia and the spore concentration was estimated by direct microscopic counting using hemocytometer [13]. The spore suspension at 1 × 108 spore/ml and volume of 20% (v/w) was mixed with the prior autoclaved growth medium. This medium was used as inoculum for SSF process.
2.2.2. Substrates Preparation and Sterilization
A mixture of sugarcane bagasse (≤2 mm) and palm kernel cake (≤0.5 mm) at 1:1 ratio was used as substrates for FPase production. The substrates were thoroughly mixed by hand prior to transfer into a newly developed fermenter, namely, FERMSOSTAT. The substrate was sterilized in situ by hot air sterilization at 130°C for 3 hours [14]. After the sterilization process, the fermenter and substrates were allowed to cool down to ambient temperature for overnight before inoculation of the substrates were carried out.
2.2.3. Medium Composition
The growth medium used in SSF process consisted of mineral salts and trace elements. The composition of the mineral salts was composed of (g/L); NH4NO3, 5.0; KH2PO4, 5.0; Corn steep liquor, 2.0; NaCl, 1.0; MgSO4.7H2O, 1.0 and trace elements (mg/L); FeSO4.7H2O, 5.0; MnSO4.4H2O, 1.60; ZnSO4.7H2O, 3.45; CoCl2, 2.0. The pH was adjusted to 7.0 prior to autoclave [15]. The pH of the growth medium was not controlled during the course of fermentation.
2.2.4. Inoculation Process
Air/water pressure type of spraying nozzles was used to spray the spore suspension and growth medium over the solid substrate. Continuous mixing of substrate by impeller was carried out during the inoculation. The air supplied was discontinued after all the spore suspension was sprayed on the substrates. However, mixing was continued for another 15 min in order to allow the absorption of the growth medium by the solid substrate.
2.2.5. Sampling Process
The growth profile of A. niger USM AI 1 and enzymes production was carried out for 6 to 7 days. About 10 g of substrate was sampled out from each of the sampling port in every 24 h. The substrate was mixed for 5 min prior to sampling process. The sample was used to determine the enzyme production and glucosamine content.
2.2.6. Enzymes Extraction
The enzyme was extracted by mixing the fermented substrates with distilled water containing 0.1% (w/v) Tween 80. The mixture was left for 2 hours in room temperature. The solid residue was separated from the enzymic solution by filtering through Whatman No. 1 filter paper [16].
2.2.7. Determination of FPase Activity
The cellulase activity is measured as FPase Activity Units. A 1 × 6 cm strip of Whatman number 1 filter paper was added to a total volume of 1.5 ml of culture filtrate in 50 mM citrate buffer (pH 4.5). The samples were incubated for 1 h at 60°C. The hydrolysis was terminated by addition of 3 ml of DNS solution, followed by 5 min boiling. After cooling, 20 ml of distilled water were added and the absorbance was read at 540 nm using glucose as standard [17].
One unit of enzyme activity was defined as the amount of enzymes, which catalyzes the liberation of 1 μmol of reducing sugar per minute under specified assay condition. Enzyme activity was expressed as unit (U) per g of fermented substrate. Enzymes productivity was expressed as unit (U) per mg of glucosamine content of the fungal growth. All assays were carried out in triplicate and the results were presented as mean of the triplicate experiments.
2.2.8. Determination of Fungal Growth
The growth of A. niger USM AI 1 was examined determining the glucosamine content of the fungus as described by Swift [18]. The glucosamine content was measured spectrophotometrically at 530 nm using glucosamine as standard.
2.2.9. Optimization of FPase Production
Factors that affect the growth of A. niger USM AI 1 and the production of FPase was determined, which included amount of substrates, moisture content, incubation temperature, aeration rate and aeration time, mixing rate, and mixing intensity. The optimum condition obtained from each experiment was used unless otherwise stated.
3. Results and Discussions3.1. Effect of Amount Substrate
The highest FPase of 2.14 U/g was obtained after 4 days of fermentation process by using 0.5 kg of substrate with about 0.66 U/mgG of FPase productivity (Figure 1). As shown in the figure, about 50% decrease in FPase activity was detected when 0.75 kg and 1.0 kg of substrate were used in the fermentation process. While Roussos et al. [19] reported about 56% reduction in FPase production when the amount substrate used in Zymotis was increased from 4 kg to 12 kg. On the other hand, according to Tao et al. [20], 11.0 U/g and 4.0 U/g of FPase activity were detected when 2 cm and 10 cm of substrate bed depths were used in SSF tray system, respectively. Significant reduction in enzymes production was detected with an increasing use of amount of substrate in the fermentation process. During sterilization, the depth of the substrate for 0.5 kg was 4 cm compared to 6 cm when 1.0 kg of substrate was used. The chances of each particle that attained 130C during the 3 h sterilization for the 6 cm depth (1 kg) substrate was relatively less than the 4 cm depth (0.5 kg) substrate. This may be due to the limitation of heat transfer especially at the center of the bed. This might be owing to the fact that sterilization cum substrate pretreatment makes the substrate more amenable to microbial attack [21].
3.2. Effect of Moisture Content
Moisture content was a crucial factor in any SSF process because this variable had influenced growth and biosynthesis of microbe as well as secretion of different metabolites such as enzymes. The result demonstrated that FPase reaching maximum level after 2 days of fermentation process using 65% and 70% (w/w) of moisture content compared with 3 days when 75% (w/w) of moisture content was used (Figure 2). Under the optimum moisture content of 70% (w/w), the highest FPase activity of 2.3 U/g and FPase productivity of 0.71 U/mgG glucosamine were gained. On the other hand, Krishna [22] and Chandra et al. [23] obtained the highest FPase activities of 2.8 U/g and 2.9 U/g under optimum moisture content of 70% and 50% (w/w), respectively. The result obtained showed no marginal differences in FPase activity at different levels of moisture content used in the fermentation process.
3.3. Effect of Incubation Temperature
The effect of different incubation temperature on FPase production and productivity is shown in Figure 3. Similar pattern of enzyme production and productivity profiles were exhibited for all the different incubation temperatures used. FPase production achieved maximum level after 5 days of fermentation process at 30°C and 32°C compared to 2 days incubated at 28°C. Under optimum incubation temperature (32°C), the highest FPase activity of 2.9 U/g was obtained with the enzyme productivity of 0.76 U/mgG glucosamine. The result obtained was in agreement with Alam et al. [24], who observed the highest FPase activity (8.2 U/g) when carried out SSF at 32°C using Trichoderma harzianum T2008 grown on empty fruit bunches for 4 days in Erlenmeyer flask. As shown in the figure, the different incubation temperatures used in the fermentation process had showed no great influence on FPase production. This possibly due to the narrow range of incubation temperatures used.
3.4. Effect of Aeration Rate
The FPase production reaching maximum level after 5 days regardless of the different aeration used during the fermentation process (Figure 4). Aeration at 4 L/h·g fermented substrate was needed for optimum FPase production with 3.0 U/g of activity and 0.83 U/mgG glucosamine of productivity. Meanwhile, no aeration and aeration at 2 L/h·g fermented substrate shown no or slight differences in the enzyme production. On the other hand, only 0.39 U/g higher in FPase production was observed when aeration used in the fermentation process was increased from 0.06 L/h·g to 0.12 L/h·g wheat straw [25]. Furthermore, Alam et al., [24] obtained FPase activity of 10.1 U/g when carried out SSF process at very low airflow rate of 0.04 L/h·g empty fruit bunches. The optimum aeration in SSF processes depends on the nature of the microorganism used, the oxygen requirements for product synthesis, the amount of heat to be removed from the mass, the degree to which carbon dioxide and other volatile metabolites must be eliminated, the thickness and the available air spaces of the substrate [21]. It can be concluded that aeration has strong influence on FPase production, in which by increasing aeration from 2 L/h·g to 4 L/h·g fermented substrate, the FPase production was increased about 22%.
3.5. Effect of Aeration Time
The effect of different aeration times on FPase production and productivity is shown in Figure 5. As demonstrated in the figure, FPase enzyme required 5 fermentation days to reach maximum level regardless of the different aeration times used during the fermentation process. In addition, no difference in FPase production was observed when 5 and 15 min of aeration time were used compared to 10 min which showed marginal differences. Fifteen minutes of aeration time showed optimum FPase production of 3.04 U/g followed by 3.01 U/g and 2.66 U/g when 5 min and 10 min of aeration time were used during the fermentation process, respectively. As also indicated in the figure, optimum aeration time (15 min) also resulted in the highest FPase productivity of 0.97 U/mgG glucosamine. While Mo et al. [26] obtained the highest FPase activity of 17.7 U/g under optimum airflow rate of 7 L/min for 15 min, the production dropped to 16.1 U/g when higher airflow rate (10 L/min) was used. In addition, the result obtained in present work was not similar to Milagres et al. [27]. The authors reported that higher aeration rate used in the fermentation process resulted in a decline in enzyme production. This is mostly due to the fact that rapidly decreased moisture level with higher air supply would occur.
3.6. Effect of Mixing Rate
The result indicated that for all different mixing rates used in the fermentation process, the enzyme production increased rapidly and reached maximum level after 5 days of the fermentation process (Figure 6). As also shown in the figure, mixing at 0.5 rpm for 5 min gives the highest FPase activity of 3.09 U/g and productivity of 0.84 U/mgG glucosamine. On the other hand, Kalogeris et al. [28] obtained FPase activity of about 4.3 U/g when the SSF process was carried out with mixing at 10 rpm for 1 min at 3 hours interval. No strong effect of mixing rate on FPase production was observed in this study. This was because FPase production achieved maximum level after 5 days regardless of the different mixing rates used in the fermentation process. This probably is due to narrow range (0.5 rpm interval) of mixing rate used during the fermentation process.
3.7. Effect of Mixing Intensity
The FPase production and productivity reaching maximum level after 5 days of the fermentation process regardless of the difference in the mixing intensity used (Figure 7). At the same time, the FPase production increased with decreasing the mixing intensity used in the fermentation process. The highest FPase activity and productivity of 3.21 U/g and 0.83 U/mgG glucosamine were detected when mixing intensity of every 24 h interval was used during the fermentation process. However, the enzyme production dropped about 17% to 2.67 U/g when 6 h interval of mixing intensity was applied during the fermentation process. Different results of agitation on microorganism growth and productivity in SSF have been reported by different authors but intermittent agitation often gives positive result [14, 29–33]. Therefore, it is necessary to study the effect of agitation for a particular SSF process. The result obtained in this study indicated that higher mixing intensity resulted in a decrease in enzymes production. This may be due to disruption of fungal attachment to the solid substrates and damage to fungal mycelial due to shear forces [34].
3.8. Comparison of Cellulases Production with <italic>Trichoderma reesei</italic>
FPase produced by A. niger USM AI 1 reaching maximum level after 5 days of fermentation process but after 6 days when the enzyme was produced by T. reesei (Figure 8). However, these findings were not similar to Chandra et al. [23] and Tao et al. [20], who obtained maximum level of FPase after 3 days of the fermentation process using Aspergillus sp. and Trichoderma sp., respectively. Present work shows that marginal differences in FPase produced by both fungal were observed, in which the highest FPase activity of 3.4 U/g and 2.2 U/g was produced by A. niger USM AI 1 and T. reesei, respectively. On the other hand, highest FPase productivity of 0.89 U/mgG and 0.78 U/mgG glucosamine were obtained by A. niger USM AI 1 and T. reesei after 7 days of the fermentation process, respectively. In can be concluded that enzyme produced by A. niger USM AI 1 required shorter fermentation days to achieve maximum level compared to enzymes produced by T. reesei. This is probably due to slow growth of T. reesei compared to A. niger USM AI 1.
4. Conclusions
In conclusion, under optimum SSF conditions of 0.5 kg substrate; 70% (w/w) moisture content; 30°C; aeration at 4 L/h·g fermented substrate for 5 min and mixing at 0.5 rpm for 5 min, about 3.4 U/g of FPase was produced by A. niger USM AI 1. At the same time, under the above same SSF conditions, about 2.2 U/g of FPase activity was obtained from T. reesei. Although the enzymes produced by T. reesei were lower compared to A. niger USM AI 1, it must keep in mind that the SSF conditions used for the enzymes production was optimum for A. niger USM AI 1 but not for T. reesei. Therefore, further optimization of SSF conditions need to be carried out for T. reesei in order to confirm which fungus was superior for FPase production using novel developed SSF bioreactor, FERMSOSTAT.
Acknowledgments
This work was mainly financed by Intensive Research Priority Area (IRPA) grant from Ministry of Science, Technology and The Environment, Malaysia. The author (C. K. Lee) would like to express his greatest appreciation and gratitude to Professor Dr. Darah Ibrahim and Professor Ibrahim Che Omar for their unlimited advice support, invaluable help, support and guidance. Moreover, the author would like to thanks USM for giving him USM fellowship.
GupteAMadamwarDSolid state fermentation of lignocellulosic waste for cellulase and β-glucosidase production by cocultivation of Aspergillus ellipticus and Aspergillus fumigatusBiotechnology Progress1997132166169Gutierrez-CorreaMTengerdyRRXylanase production by fungal mixed culture solid substrate fermentation on sugar cane bagasseBiotechnology Letters19982014547HangYDWoodamsEEProduction of citric acid from corncobs by Aspergillus nigerBioresource Technology1998653251253KotwalSMGoteMMSainkarSRKhanMIKhireJMProduction of α-galactosidase by thermophilic fungus Humicola sp. in solid-state fermentation and its application in soyamilk hydrolysisProcess Biochemistry1998333337343SekarCBalaramanKOptimization studies on the production of cyclosporin A by solid state fermentationBioprocess Engineering1998184293296DurandAChereauDA new pilot reactor for solid-state fermentation: application to the protein enrichment of sugar beet pulpBiotechnology and Bioengineering198831547648618584634XueMLiuDZhangHQiHLeiZA pilot process of solid state fermentation from sugar beet pulp for the production of microbial proteinJournal of Fermentation and Bioengineering1992733203205DurandARenaudRMaratrayJAlmanzaSDiezMINRA-Dijon reactors for solid state fermentation: designs and applicationsJournal of Scientific and Industrial Research1996555-6317332FernándezMPérez-CorreaJRSolarIAgosinEAutomation of a solid substrate cultivation pilot reactorBioprocess Engineering199616114PandeyAAspects of fermenter design for solid-state fermentationsProcess Biochemistry1991266355361MitchellDABerovicMKriegerNMitchellDAKriegerNBeroviMIntroduction to solid state fermentation bioreactorsSolid State Bioreactors: Fundamentals of Design and Operation2006Berlin, GermanySpringer3344SmitsJPRinzemaATramperJVan SonsbeekHMKnolWSolid-state fermentation of wheat bran by Trichoderma reesei QM9414: substrate composition changes, C balance, enzyme production, growth and kineticsApplied Microbiology and Biotechnology1996465-6489496RaimbaultMAlazardDCulture method to study fungal growth in solid fermentationEuropean Journal of Applied Microbiology and Biotechnology198093199209LonsaneBKSaucedo-CastanedaGRaimbaultMScale-up strategies for solid state fermentation systemsProcess Biochemistry1992275259273KhengPPDarahIPoppeLSzakacsGIbrahimCOXylanase production by local isolate, Trichoderma spp. FETL C3-2 via solid-state fermentation using agricultural wastes as substratesMalaysian Journal of Microbiology20062714AikatKBhattacharyyaBCProtease extraction in solid state fermentation of wheat bran by a local strain of Rhizopus oryzae and growth studies by the soft gel techniqueProcess Biochemistry2000359907914GhoseTKMeasurement of cellulase activitiesPure Applied Chemistry198759257268SwiftMJThe estimation of mycelial biomass by determination of the hexosamine content of wood tissue decayed by fungiSoil Biology and Biochemistry197353321332RoussosSRaimbaultMPreboisJ-PLonsaneBKZymotis, a large scale solid state fermenter design and evaluationApplied Biochemistry and Biotechnology19934213752TaoSZuohuLDemingLA novel design of solid state fermenter and its evaluation for cellulase production by Trichoderma viride SL-1Biotechnology Techniques19961011889894LonsaneBKChildyalNPBudiatmanSRamakrishnaSVEngineering aspects of solid state fermentationEnzyme and Microbial Technology198576258265KrishnaCProduction of bacterial cellulases by solid state bioprocessing of banana wastesBioresource Technology1999693231239ChandraMSViswanathBReddyBRCellulolytic enzymes on lignocellulosic substrates in solid state fermentation by Aspergillus nigerIndian Journal of Microbiology2007474323328AlamMDZMamunAAQudsiehIYMuyibiSASallehHMOmarNMSolid state bioconversion of oil palm empty fruit bunches for cellulase enzyme production using a rotary drum bioreactorBiochemical Engineering Journal20094616164KalogerisEIniotakiFTopakasEChristakopoulosPKekosDMacrisBJPerformance of an intermittent agitation rotating drum type bioreactor for solid-state fermentation of wheat strawBioresource Technology200386320721312688461MoHZhangXLiZControl of gas phase for enhanced cellulase production by Penicillium decumbens in solid-state cultureProcess Biochemistry2004391012931297MilagresAMFSantosEPiovanTRobertoICProduction of xylanase by Thermoascus aurantiacus from sugar cane bagasse in an aerated growth fermentorProcess Biochemistry2004391113871391KalogerisEFountoukidesGKekosDMacrisBJDesign of a solid-state bioreactor for thermophilic microorganismsBioresource Technology1999673313315SilmanRWEnzyme formation during solid-substrate fermentation in rotating vesselsBiotechnology and Bioengineering19802224114206243500MitchellDADoelleHWGreenfieldPFImprovement of growth of Rhizopus oligosporus on a model solid substrateBiotechnology Letters1988107497502KargiFCurmeJASolid-state fermentation of sweet sorghum to ethanol in a rotary-drum fermentorBiotechnology and Bioengineering19852781122112518553793KumarPKRLonsaneBKPotential of fed-batch culture in solid state fermentation for production of gibberellic acidBiotechnology Letters198793179182KumarPKRLonsaneBKBatch and fed batch solid state fermentation: kinetics of cell growth, hydrolytic enzymes production and gibberellic acid productionProcess Biochemistry1988234347LonsaneBKDurandARenaudRDoelleHWMitchellDARolzCWProduct leaching and downstream processingSolid Substrate Cultivation1992London, UKElsevier Science147171
Effect of different amount of substrates on FPase production.
Effect of different moisture contents on FPase production.
Effect of different incubation temperatures on FPase production.
Effect of different aeration rates on FPase production.
Effect of different aeration time on FPase production.
Effect of different mixing rates on FPase production.
Effect of different mixing intensities on FPase production.
Production of FPase enzyme by A. niger USM AI 1 and T. reesei under optimized fermentation conditions.
oai:pubmedcentral.nih.gov:30426722011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30426722135066610.4061/2011/685023Research ArticleImmobilization of Rose Waste Biomass for Uptake of Pb(II) from Aqueous SolutionsAnsariTariq Mahmood1HanifMuhammad Asif2*MahmoodAbida1IjazUzma1KhanMuhammad Aslam3NadeemRaziya2AliMuhammad41Department of Environmental Sciences, GC University, Faisalabad 38000, Pakistan2Department of Chemistry and Biochemistry, University of Agriculture, Faisalabad 38040, Pakistan3Institute of Horticultural Sciences, University of Agriculture, Faisalabad 38040, Pakistan4Department of Chemistry, University of Sargodha, Sargodha 40100, Pakistan*Muhammad Asif Hanif: muhammadasifhanif@ymail.com
Rosa centifolia and Rosa gruss an teplitz distillation waste biomass was immobilized using sodium alginate for Pb(II) uptake from aqueous solutions under varied experimental conditions. The maximum Pb(II) adsorption occurred at pH 5. Immobilized rose waste biomasses were modified physically and chemically to enhance Pb(II) removal. The Langmuir sorption isotherm and pseudo-second-order kinetic models fitted well to the adsorption data of Pb(II) by immobilized Rosa centifolia and Rosa gruss an teplitz. The adsorbed metal is recovered by treating immobilized biomass with different chemical reagents (H2SO4, HCl and H3PO4) and maximum Pb(II) recovered when treated with sulphuric acid (95.67%). The presence of cometals Na, Ca(II), Al(III), Cr(III), Cr(VI), and Cu(II), reduced Pb(II) adsorption on Rosa centifolia and Rosa gruss an teplitz waste biomass. It can be concluded from the results of the present study that rose waste can be effectively used for the uptake of Pb(II) from aqueous streams.
1. Introduction
Mobilization of the heavy metals in the environment due to industrial activities is of serious concern due to toxicity of these metals in human and other forms of life. Lead (II) is known to be one of the heavy metals most toxic to living organisms and is one of the more wide spread heavy metal contaminants on the environment [1]. Once it enters the environment, it is difficult to recover and it affects the human health [2]. Pb(II) is considered as neurotoxic metal when present above 0.05 mg/L in drinking water [3]. Lead is a metabolic poison and enzyme inhibitor. In young children it can cause mental retardation and semipermanent brain damage. Lead has the ability to form sites for long term release by replacing calcium in the bone. In environmental restoration areas conventional techniques used to eradicate heavy metals from wastewater include precipitation, oxidation/reduction, mechanical filtration, ion exchange resins, membrane separation, adsorption, flocculation, coagulation, and reverse osmosis [4, 5]. However, these processes can be expensive and not fully effective especially when the metal concentration is below 100 mg/L. The other drawbacks of these methods include expensive equipment and monitoring system, high reagents, energy and generation of toxic sludge which requires massive land for dumping. Biosorption has some advantages when compared with conventional methods (1) it is nonpolluting and highly selective; (2) more efficient; (3) easy to operate; (4) cost-effective for treatment of large volumes of wastewaters which contains low concentrations of metals [6]. A biosorbent's immobilization procedure is necessary for the industrial application of biosorption [7]. Everywhere in the world roses are cultivated as important shrubs. These are ornamental plants; they are also used in medicines, perfumes, and for fragrance. From rose, oil is extracted that is used in perfumes and fragrance. Distillation of rose yield three products: Rose oil, rose water, and rose waste biomass [8].
The present study is undertaken (1) to evaluate the usefulness of immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass as a biosorbent for Pb(II) in a single and multicomponent aqueous solutions; (2) to evaluate the effect of different experimental variables like pH, biosorbent dose, initial metal concentration of Pb(II), contact time, column study on sorption process; (3) to investigate the effects of different pretreatments on the sorption capacity (mg/L) of Pb(II); (4) to investigate the metal desorption from loaded waste biomass.
2. Materials and Methods2.1. Reagents
All chemicals used in these studies were of analytical grade and were purchased from E. Merck Company (Darmstadt, Germany). The reagents used in this study were HCl, H2SO4, NaOH, CaCl2, Lead Acetate, Sodium Alginate, H3PO4, Triton X-100, CH3OH, AlCl3, Ca(OH)2, Al(OH)3, Na2SO4, K2Cr2O7, and Pb(II) standard solution 1000 mg/L. The stock solution of lead was prepared by dissolving 1.83 g of Lead acetate (CH3COOPb) in 100 mL of deionized distilled water (DDW) and diluted up to 1000 mL. Then solutions of desired concentrations were prepared from the stock solution.
2.2. Biomass
In the present study the rose distillation sludge was selected as biosorbent. Rosa centifolia and Rosa gruss an teplitz waste biomass used in this work was harvested from Rose Laboratory, Institute of Horticultural sciences, University of Agriculture, Faisalabad, Pakistan. The obtained biomass was washed with distilled water to remove impurities and particulate matter. The obtained biomass was first sun dried and then oven dried at 60°C for 24 hour to obtain biomass in completely dried form. Standard sampling techniques were used to ensure the collection of homogenous sample. The dried waste biomass was then pulverized and finally sieved (0.25 mm). The biomass was immobilized by mixing 1 g of dried biomass and 2 g Na alginate in 100 ml of deionized distilled water. The alginate-biomass mixture was extruded through a 100 mL burette into 0.15 M CaCl2 solution for bead formation. The spherical beads (3.5 mm) were preserved in 50 mM CaCl2 until further use.
2.3. Pretreatment of Biomass
The immobilized Rosa centifolia and Rosa gruss an teplitz biomass was physically modified by heating (0.1 g of beads in an electric oven at 60°C for 30 minutes) and boiling (0.1 g of beads in 100 ml of deionized distilled water for 30 minutes). One gram of immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass pretreated using 1000 mL of 0.1 N H2SO4, H3PO4, Ca(OH)2, Al(OH)3, and CH3OH for 24 hours. The surface of immobilized biomass (1 g) was mobilized using 1000 ml of 1% Triton X-100 for 24 hours. The immobilized biomass weight was taken on dry weight basis during the present study (0.1 g of dried immobilized biomass was equal to 1 g of fresh immobilized biomass).
2.4. Biosorption Studies
The effect of pH (1, 2, 3, 4, and 5), biosorbent dose (0.05, 0.1, 0.2, 0.3, and 0.4 g/100 mL), initial metal concentration (25, 50, 100, 200, 400, and 800 mg/L), contact time (5, 10, 15, 30, 60, 120, 240, 360, 720, and 1440 minutes), and Co-metals ions (Na, Ca(II), Al(III), Cr(III), Cr(VI), Cu(II)) on the sorption of Pb(II) were evaluated during the present study. The pH of aqueous medium was adjusted using 0.1 M HCl and 0.1 M NaOH were used. In the end of each experiment, solution was separated from the waste biomass by filtration. The controls were accompanied each experiment. The concentration of Lead in the solution before and after the experiment was determined by using Flame Atomic Absorption Spectrophotometer (FAAS), using a Perkin-Elmer AAnalyst 300 (FAAS) equipped with air-acetylene burner. The selected analytical wavelength for Lead was 232 nm. The instrument was periodically checked by known standards to ensure the accuracy. For each sample three readings were taken and mean of these three was computed along with standard deviations for each sample. The amount of metal biosorbed on each waste biomass was assumed to the difference between initial metal concentration and that present in the solution. Uptake was calculated by concentration difference method. The uptake of Pb(II) was calculated by the simple concentration method. The metal uptake (qe) and % age removal were calculated from the mass balance and % age removal equations as follows:
qe=V(Ci−Ce)1000w,
where V is the volume of solution in mg/L and w is the mass of sorbent, Ci is the initial concentration (mg/L), and Ce is the metal concentration at the various time intervals and qe is the metal uptake in (mg/g).
The extent of sorption in percentage is found from the relation
Sorption(%)=(Ci−Ce)×100Ci.
2.5. Statistical Analysis
The data given in this study represents the mean of three independent experiments. All results are evaluated by mean ± SD values. The correlation coefficient (R2) values of the linear form of Langmuir isotherm, Freundlich isotherm, pseudo-first-order and pseudo-second-order models were also determined using statistical functions of Microsoft Excel (version Office XP, Microsoft Cooperation, USA).
3. Results and Discussions3.1. Effect of pH
One of the most important factors in the biosorption studies is the degree of acidity of the medium. Aqueous solution pH is a critical parameter as it strongly affects metal biosorption, surface charge of the adsorbent, degree of ionization, and speciation of adsorbate species. It affects the solution chemistry of metals, the activity of functional groups in the biomass, and competition of the metallic ions [6]. Maximum lead removal was observed at pH 5 (Figure 1). When pH was further increased, the soluble lead became precipitated. With an increase in pH, the functional groups on the cell wall with negative charge increase due to deprotonation of the metal binding sites, which promotes the metal uptake [3]. Nasir et al., [8] also observed maximum lead removal at pH 5 with untreated and treated waste biosorbent. It was reported that at highly acidic pH (<3) lead (II) ions compete with H+ on the binding sites of cells and adsorption is lowered. When the solution pH increased beyond 5, the insoluble precipitates formed making true sorption studies impossible [9].
3.2. Effect of Biosorbent Dose
The results show that maximum biosorption by immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass occurred at 0.05 g/100 ml for Pb(II) solution (Figure 2). This shows that the maximum adsorptions occur at minimum dose and hence the amount of ions bound to the adsorbent and amount of free ions remained constant. After this dose, the uptake capacity (mg/g) of biosorbent was gradually decreased with increase in dose. Amount of biosorbent added to the solution determines the number of binding sites available for adsorption. The results can be attributed to some kind of hindrance as due to partial aggregation/agglomeration of sorbet particles at higher concentration (Figure 2). Therefore, a more economical removal of a given amount of metal ions can be carried out using small batches of sorbent rather than in a single batch [10, 11].
3.3. Effect of Initial Metal Concentration
Removal of Pb(II) by immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass at different metal concentrations (25, 50, 100, 200, 400, and 800 mg/L), at constant pH 5 is shown in the Figure 3. The obtained results indicated that Pb(II) sorption capacity of immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass increased up till 200 mg/L afterwards a decrease was observed. This sorption characteristic has indicated that surface saturation is dependent on the initial metal ion concentrations. At low concentration, the ratio of sorptive surface area to the total metal ions available is high; adsorption sites have taken the available metal more quickly. The difference between the bulk and surface metal ions concentration is one of the driving forces to overcome the resistance to sorption process, in the absence of mass transfer resistances, surface and bulk concentration are identical, thus, enhancing the sorption process. However, at higher concentrations, metals need to diffuse to the biomass surface by intraparticle; diffusion and greatly hydrolyzed ions will diffuse at a slower rate [12]. There are several equations of isotherm which have been used for equilibrium modeling for the systems of biosorption [2]. For this study, two frequently used equations Langmuir and Freundlich isotherm models were selected. In Langmuir model the maximum adsorption capacity qmax (mg/g) and other parameters were determined from
Ceqe=1qmax·KL+Ceqmax,
where qe is metal sorption capacity (mg/g), Ce the equilibrium concentration of metal ions solution, KL is the Langmuir adsorption constant.
The adsorption on heterogeneous surface of biomass can be determined by the log form of Freundlich isotherm in
logqe=1nlogCe+logk,
where k and n are Freundlich constants.
Table 1 shows the correspondent constants along with the coefficients of correlation (R2) associated to each linearized model. The results indicated that the model better fitted to the data was Langmuir model due to higher value of its correlation coefficient. The well fitting of experimental data to Langmuir model clearly demonstrated that Pb(II) sorption onto immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass was a surface phenomenon.
3.4. Effect of Contact Time
The equilibrium time is one of the important parameters for an economical wastewater treatment system [13–18]. The effect of the contact time on Pb(II) biosorption immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass was studied by varying time interval in range of 5–1440 minutes at constant values of pH (5), biosorbent dose (0.1 g/100 mL), and initial metal concentration (100 mg/L) at 30°C (Figure 4). It was observed that an equilibrium time of 240 minutes was necessary to reach the equilibrium for Pb(II) biosorption. A further increase in time did not show an increase in biosorption. It is well known that rate of metal uptake is influenced by factors effecting mass transfer from bulk solution to binding sites [6]. To understand the adsorption mechanism of Pb(II) on to immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass, modeling of data was performed using Lagergren pseudo-first-order and pseudo-second-order kinetic models. The linearized form of pseudo-first-order equation (5) is given as
log(qe−q)=logqe−k1,adst2.303,
where qe is the mass of metal adsorbed at equilibrium (mg/g), qt is the mass of metal at time t (min.), k1,ads is the first-order reaction rate of adsorption (per min.).
The pseudo second order is expressed in
tqt=1k2qe2+tqe,
where k2 is the rate constant of pseudo-second-order biosorption model (g/mg/min).
A comparison (Table 2) between kinetic models suggested that the coefficient of correlation (R2) for the pseudo-second-order kinetic model is much higher in comparison to pseudo-first-order model. The value of experimental qe (mg/g) and qmax (mg/g) is in good agreement for pseudo-second-order kinetic model. So, it is suggested that the model fitted to data was pseudo-second-order kinetic model.
3.5. Effect of Co-Metals
In order to investigate the effect of other metal ions, present in the aqueous solution, on the uptake capacity (mg/g) of Pb(II) immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass, a study was conducted at a constant values of pH 5, biosorbent dose (0.1 g/100 mL), and initial metal concentration (100 mg/L) at 30°C (Figures 5(a)–5(f)). Among all the metals studied, Pb(II) has highest electronegativity value (2.33), so, having highest affinity for binding sites. The order of electronegativity for other metals is given as Na(I)0.93 < Ca(II)1.00 < Al(III)1.61 < Cr(II)1.66 < Cr(VI)1.66 < Cu(II)1.9 < Pb(II)2.33. When we consider atomic number as a major factor affecting uptake capacity of Pb(II) by immobilized waste biomass, then, the order of atomic numbers for the co-metals studied is Pb(II)82 > Cu(II)29 > Cr(III)24 > Cr(VI)24 > Ca(II)20 > Al(III)13 > Na(I)11. Because of highest atomic number from all other studied metals, Pb(II) can easily replace other metal ions from the binding sites. The higher value of ionic radii for Pb(II) 1.32, also favored Pb(II) sorption as compared to other metals. Pb(II) also has highest Standard Potential value (−0.126) E° (Volts) after Cu(II), so it can easily replace any metal from biomass surface. Among all the co-metals studied in this experiment, only Al(III) has strongly affected the sorption capacity of Pb(II) by immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass due to it is higher ionic charge than Pb(II). After Al(III), second competing metal ion with Pb(II), was Cu(II). This could be due to higher Standard potential values for Cu(II) (0.34 E° Volts), as compared to Pb(II) (−0.126 E° Volts), which enabled Cu(II) to replace Pb(II) from the binding sites. From the studies of the competitive adsorption of Cu(II) and Pb(II), we can come to a conclusion that because both metals have same ionic charge, mechanism of the two metal ions is in homology nearly. The tendency for adsorbed Pb(II) was higher than that for Cu(II) at the initial process [19]. After Cu(II), the metal who competed most with Pb(II) for binding sites, was Cr(VI). This could be probably due to higher ionic charge. Other metal ions like Na(I), Ca(II), and Cr(III) also effected the sorption capacity of Pb(II) by immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass to some extent. The results showed that there was a decrease in Pb(II) uptake as the concentration of co-metal ion increased. In the presence of coions in solution, chemical interactions between the ions themselves as well as with the biomass, take place resulting in site competition. Many of the functional groups present on the cell wall and the membrane are nonspecific and different cations compete for the binding sites. It has been reported that metal removal is increased as the ionic radii of metal cations affect the ion exchange and adsorption process. The differences in the sorption affinities may also be attributed to differences in the electrode potentials of the various ions. The greater the electrode potential, the greater is the affinity for biomass [13]. The process of metal removal is inhibited in the presence of other ions. The presence of a multiplicity of metals leads to interactive effect. These effects can be extremely complex and three types of responses may be expected: (i) the effects of mixture is greater than that of the individual effects of ions in the mixture (synergism); (ii) the effects of mixture is less than that of the individual effects of ions in the mixture (antagonism); (iii) no effect of mixture (no interaction). The actual mechanisms of heavy metal adsorption especially multicomponents are not well understood and need further detailed studies.
3.6. Effect of Pretreatment
An increase in biosorption of lead (II) ions as a result of pretreatment could be due to an exposure of active metal binding sites embedded in the cell wall or chemical modifications of the cell wall components. The effect of pretreatment on uptake capacity of immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass is shown in Figure 6. The metal sorption capacity (mg/g) of physically treated Rosa centifolia was Immobilized (91.36) > Heated immobilized (65.43) > Boiled immobilized (52.47) > Native (38.61). The metal sorption capacity (mg/g) of physically treated immobilized Rosa gruss an teplitz waste biomass was Boiled (77.78) > Heated (46.43) > Native (36.62). Boiling removes mineral matter from biomass and increase number of vacant biosorbents sites. Heating biomass results in decomposition of organic matter and increases the metal uptake by increasing newly vacant biosorbent sites [14]. After alkali pretreatment biosorption capacity (mg/g) of immobilized Rosa centifolia waste biomass was Al(OH)3 (101.32) > Ca(OH)2 (56.57). The metal sorption capacity (mg/g) of alkali pretreated immobilized Rosa gruss an teplitz waste biomass was Al(OH)3 (99.3) > Ca(OH)2 (99.04). Autolytic enzymes may be destroyed by alkali treatment which cause putrefaction of biomass and remove proteins and lipids that mask reactive sites [15]. After acid pretreatment, biosorption capacity (mg/g) of immobilized Rosa centifolia waste biomass was: HCl (99.834) > H3PO4 (87.36) > H2SO4 (75.27). After acid pretreatment, the biosorption capacity (mg/g) of immobilized Rosa gruss an teplitz waste biomass was H3PO4 (91.71) > H2SO4 (69.5) > (HCl) (26.38). After acid pretreatment a negative charge occurs on the surface of biomass due to ionization of organic and inorganic groups. Increased charge on biomass surface was responsible for increase in Pb(II) uptake capacity of biomass. Methanol and Triton X-100 pretreatment of both biosorbents resulted in increase in Pb(II) uptake capacity. Triton X-100 is nonionic surfactant. The sorption of heavy metal to the biomass can be increased in the presence of surfactants because they reduce the surface tension as well as increasing wetting power, allowing easier spreading and lowering the interfacial tension between two substances [15]. Pretreatment with methanol results in the methylation of amino groups present on the surface of waste biomass. Drake et al. [16] also observed that the treatment of biomass with methanol result in esterification of carboxylic acids present on the cell wall of biosorbents [17].
3.7. Column Study
For practical applications it is necessary to determine the maximum Pb(II) uptake in column setup. Column study was conducted at pH 5, initial metal concentration 100 mg/L, biosorbent dose 0.5 g, for a time range of 5, 10, 20, 30, 60, 120, and 240 minutes. The equilibrium time for column setup was 240 minutes in comparison to 360 minutes in case of batch setup (Figure 7). Modelling of the data was done using pseudo-first-order kinetic model and pseudo-second-order model. A comparison between kinetic models is given in Table 3, which suggested that the coefficient of correlation (R2) for the pseudo-second-order kinetic model is much higher as comparison to pseudo-first-order kinetic model. The value of experimental qe (mg/g) and qmax (mg/g) is in good agreement for pseudo-second-order kinetic model. Column setup was found to have significantly low adsorption capacity in comparison to batch set up [18].
3.8. Desorption Experiments
Disposal of exhausted adsorbent loaded with heavy metal ions creates another environmental problem as it is hazardous material which pollute environment. This problem may be overcome to some extent by using one of the elimination (e.g., elution, incineration, and pyrolysis) methods. The elution of heavy metal is the most common elimination method, allowing both recovery of solution of heavy metal ions at higher concentration for inertisation and recycling of the adsorbent for subsequent uses [19]. The desorption of loaded immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass was evaluated using 0.1 N HCl, H2SO4, and H3PO4, used as desorbing agents (Figure 8). The percentage recovery of Pb(II) from loaded pretreated with 0.1 N acids, waste biomass is in order: H2SO4> H3PO4> HCl. The high percentage recovery of Pb(II) allows the reuse of biomass and is an important feature for its possible use in continuous system in industrial process and in analytical procedures for preconcentration of trace elements.
In order to find out functional groups responsible for Pb(II) biosorption, FTIR analysis of the biomass was carried out before and after metal uptake. FTIR spectra shows the involvement of amino (–NH), carboxylate anions (–COO−), hydroxy (–OH), and others (–C–N), (–C–O), (–C–H), (–C=O) which present different affinities towards metallic ions [27]. The broadband after 3500 cm−1 indicates O–H stretching and the lower intensity band near 2900 cm−1 represents stretching of the O–H groups bound to methyl and methylene radicals; these groups are present on the lignin structure. A broad, intense –OH stretching absorption band from 3300 to 2500 cm−1 present in FTIR spectrum of biomasses indicated the carboxylic functional group present on biomass cell surface. Weaker –CH stretch bands are superimposed onto the side of the broad –OH band at 3000–2800 cm−1. The peaks located at 1800–1600 cm−1 are characteristics of carbonyl group stretching from aldehydes and ketones. Aromatic rings stretching bands associated with C–C can be seen between 1600 to 1500 cm−1. The bands present near 1450 cm−1 indicated that the –NH was also involved in metal biosorption. The absorbance of the peaks in the metal loaded sample was substantially lower than those in the raw sample. This indicated that bond stretching occurred to a lesser degree due to the exchange of hydrogen ions with Pb(II), and subsequently peak absorbance was attenuated.
3.10. Pb(II) Uptake Capacity Comparison
A comparison between Pb(II) uptake capacity of immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass with some previously used biosorbents is tabulated in Table 4 [20–26]. From Table 4 it can be concluded that immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass has more sorption capacity in comparison to most of the earlier reported biosorbents.
4. Conclusions
Following are the main conclusions that can be withdrawn from the present study.
The Pb(II) uptake by immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass was found highly dependent on physiochemical parameters such as pH, dosage, chemical pretreatment, initial metal concentration, co-metal ion concentration, and contact time as well as on batch or continuous setup.
Alkali pretreatment of immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass using Al(OH)3 was found more effective than chemical and physical pretreatments to increase uptake capacity of biomass.
Langmuir adsorption isotherm and pseudo second-order models were best fitted to the experimental results.
Pb(II) was effectively desorbed from immobilized Rosa centifolia and Rosa gruss an teplitz waste biomass using acids. The effectiveness of various acids towards Pb(II) desorption was found as follows: H2SO4> H3PO4> HCl.
FTIR analysis of rose waste biomass indicates the involvement of carbonyl, carboxyl, hydroxyl, aromatic, and amino functional groups in Pb(II) uptake process.
DönmezGAksuZBioaccumulation of copper(II) and nickel(II) by the non-adapted and adapted growing CANDIDA SPWater Research20013561425143411317889NadeemRAnsariTMKhalidAMFourier Transform Infrared Spectroscopic characterization and optimization of Pb(II) biosorption by fish (Labeo rohita) scalesJournal of Hazardous Materials20081561–3647318242826SagYOzerDKutsalTA comparative study of the biosorption of lead(II) ions to Z. ramigera and R. arrhizusProcess Biochemistry1995302169174MehtaSKGaurJPUse of algae for removing heavy metal ions from wastewater: progress and prospectsCritical Reviews in Biotechnology200525311315216294830BashaSMurthyZPMasonLGSeaweeds for engineering metal biosorption: are viewFocus on Hazardous Materials Research2007Hauppauge, NY, USANova Science165209HanifMANadeemRBhattiHNAhmadNRAnsariTMNi(II) biosorption by Cassia fistula (Golden Shower) biomassJournal of Hazardous Materials2007139234535516860463Al-HakawatiMSBanksCJCopper removal by polymer immobilised Rhizopus oryzaeWater Science and Technology2000427-8345352NasirMHNadeemRAkhtarKHanifMAKhalidAMEfficacy of modified distillation sludge of rose (Rosa centifolia) petals for lead(II) and zinc(II) removal from aqueous solutionsJournal of Hazardous Materials200714731006101417363153HoY-SEffect of pH on lead removal from water using tree fern as the sorbentBioresource Technology200596111292129615734317MontanherSFOliveiraEARollembergMCRemoval of metal ions from aqueous solutions by sorption onto rice branJournal of Hazardous Materials20051172-320721115629578QuekSYAl-DuriBWaseDAJForsterCFCoir as a biosorbent of copper and leadProcess Safety and Environmental Protection19987615054SaeedAIqbalMAkhtarMWRemoval and recovery of lead(II) from single and multimetal (Cd, Cu, Ni, Zn) solutions by crop milling waste (black gram husk)Journal of Hazardous Materials20051171657315621354MattuschkaBStraubeGBiosorption of metals by a waste biomassJournal of Chemical Technology and Biotechnology19935815763ZubairABhattiHNHanifMAShafqatFKinetic and equilibrium modeling for Cr(III) and Cr(VI) removal from aqueous solutions by Citrus reticulata waste biomassWater, Air, and Soil Pollution20081911–4305318MuraleedharanTRVenkobacharCMechanism of cobalt biosorptionBiotechnology and Bioengineering199033823831DrakeLRLinSRaysonGDJacksonPJChemical modification and metal binding studies of Datura innoxiaEnvironmental Science and Technology1996301110114Gardea-TorresdayJLCano-AguileraITiemannJKWebbRGutierrez-CoronaFCopper binding by inactivated cells of Mucor rouxiiIn: Proceedings of the 10th Annual Conference on Hazardous Waste ResearchMay 1995Manhattan, Kan, USA3340HoY-SEffect of pH on lead removal from water using tree fern as the sorbentBioresource Technology200596111292129615734317HanRZhangJZouWXiaoHShiJLiuHBiosorption of copper(II) and lead(II) from aqueous solution by chaff in a fixed-bed columnJournal of Hazardous Materials20061331–326226816298055KeskinkanOGoksuMZLBasibuyukMForsterCFHeavy metal adsorption properties of a submerged aquatic plant (Ceratophyllum demersum)Bioresource Technology200492219720014693453KeskinkanOGoksuMZLYuceerABasibuyukMForsterCFHeavy metal adsorption characteristics of a submerged aquatic plant (Myriophyllum spicatum)Process Biochemistry2003392179183AkarTTunaliSBiosorption characteristics of Aspergillus flavus biomass for removal of Pb(II) and Cu(II) ions from an aqueous solutionBioresource Technology200697151780178716256347LiuYChangXGuoYMengSBiosorption and preconcentration of lead and cadmium on waste Chinese herb Pang Da HaiJournal of Hazardous Materials20061351–338939416488078TunaliSÇabukAAkarTRemoval of lead and copper ions from aqueous solutions by bacterial strain isolated from soilChemical Engineering Journal20061153203211TüzünIBayramoğluGYalçinEBaşaranGÇelikGAricaMYEquilibrium and kinetic studies on biosorption of Hg(II), Cd(II) and Pb(II) ions onto microalgae Chlamydomonas reinhardtiiJournal of Environmental Management2005772859215993534LodeiroPBarriadaJLHerreroRSastre de VicenteMEThe marine macroalga Cystoseira baccata as biosorbent for cadmium(II) and lead(II) removal: kinetic and equilibrium studiesEnvironmental Pollution2006142226427316360252SelatniaABoukazoulaAKechidNBakhtiMZCherguiAKerchichYBiosorption of lead (II) from aqueous solution by a bacterial dead Streptomyces rimosus biomassBiochemical Engineering Journal2004192127135
Effect of pH on Pb(II) uptake by immobilized rose waste biomass.
Effect of pH on Pb(II) uptake by immobilized rose waste biomass.
Effect of initial metal concentration on Pb(II) uptake by immobilized rose waste biomass.
Effect of contact time on Pb(II) uptake by immobilized rose waste biomass.
Effect of biosorbent pretreatment on Pb(II) uptake by immobilized rose waste biomass.
Effect of contact time on Pb(II) uptake by immobilized rose waste biomass in column setup.
Desorption of Pb(II) by immobilized rose waste biomass.
Comparison between Langmuir and Freundlich adsorption isotherm parameters for Pb(II) sorption by immobilized rose waste biomass.
Biosorbent
Langmuir isotherm parameters
Experimental value
Freundlich isotherm parameters
qmax (mg/g)
KL (l/mg)
R2
qmax (mg/g)
qmax (mg/g)
K (mg/g)
1/n
R2
Rosacentifolia
101.01
0.2964
0.9979
97.4
117.76
1.508
0.2809
0.5515
Rosa gruss an teplitz
102.04
0.1884
0.9932
97.2
365.51
1.9484
0.3065
0.3965
A comparison between Lagergren pseudo-first-order and pseudo-second-order kinetic models for Pb(II) uptake by immobilized rose waste biomass.
Biosorbent
Pseudo-first-order kinetic model
Experimental value
Pseudo-second-order kinetic model
qe(mg/g)
K1,ads (min−1)
R2
qe (mg/g)
qe (mg/g)
K2,ads (g mg−1 min−1)
R2
Rosa centifolia
51.59
0.0133
0.9455
97.399
101.01
5.99×10−4
0.9912
Rosa gruss an teplitz
147.8
1.059
0.8786
98.67
113.64
0.774 x10−4
0.9585
A comparisons between Lagergren pseudo-first-order and pseudo-second-order kinetic models for Pb(II) uptake by immobilized rose waste biomass in column setup.
Biosorbent
Pseudo-first-order kinetic model
Experimental value
Pseudo-second-order kinetic model
qe(mg/g)
K1,ads (min−1)
R2
qe (mg/g)
qe (mg/g)
K2,ads (g mg−1 min−1)
R2
Rosa centifolia
6.74
0.0103
0.9806
9.122
9.98
2.93
0.9631
Rosa gruss an teplitz
1.98
0.0115
0.4495
7.028
6.83
0.09862 × 10−4
0.9607
A comparison between immobilized rose waste biomass and previously used biosorbent for the uptake of Pb(II).
Biosorbent
Uptake capacity (mg/g)
Reference
Immobilized Rosa centifolia
97.399
Present study
Immobilized Rosa gruss an teplitz
98.67
Ceratophyllum demersum
44.80
[20]
Myriophyllum spicatum
46.49
[21]
Aspergillus flavus
10.82
[22]
Waste chinese herb Pang Da Hai
27.10
[23]
Bacillus sp.
92.27
[24]
Chlamydomonas reinhardtii
96.30
[25]
Brown seaweed Cystoseira baccata.
186
[26]
oai:pubmedcentral.nih.gov:30426782011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30426782135066710.4061/2011/737636Research ArticleSomatic Embryogenesis in Four Tree LegumesDasPremananda*Vision MGM Agri-Tech and Research Institute Pvt. Ltd., C-122 (HIG), Baramunda, Bhubaneswar-751 003, Orissa, India*Premananda Das: pdas2001@gmail.com
Somatic embryogenesis was achieved in four leguminous tree species, that is, Acacia catechu, Acacia arabica, Hardwickia binata, and Dalbergia sissoo using immature zygotic embryos as explants on Murashige and Skoog (MS) medium supplemented with 0.25–1.0 mg/l Kn (kinetin) and 2.0–3.0 mg/l 2,4-D (2,4-dichlorophenoxyacetic acid) or NAA (1-napthaleneacetic acid) and 3% sucrose. MS medium containing 2.0 mg/l 2,4-D and 1.0–1.5 mg/l Kn was noted to be most effective in inducing friable embryogenic callus (FEC); the number of somatic embryos per culture varied in MS medium supplemented with 1.0–2.0 mg/l 2,4-D or NAA and 0.25–1.5 mg/l kinetin. The maximum number of somatic embryos was obtained in MS medium containing 1.5–2.0 mg/l 2,4-D or NAA and 1.0–1.5 mg/l kinetin; proliferation of embryogenic calli was enhanced in cultures having 1.0–2.0 mg/l 2,4-D, 1.0–1.5 mg/l kinetin, and 400–600 mg/l L-Proline. The somatic embryos in various shapes and sizes after the first subculture on MS medium supplemented with 0.1 mg/l IAA and 0.25 mg/l BA; developed shoots and rooted in 1/2 strength MS medium supplemented with 0.1 mg/l IBA or IAA. The somatic embryo-derived plantlets were transferred to the field after being hardened in the climate-controlled hardening chamber.
1. Introduction
Tree legumes, once established, grow faster than other tree species even under poorly managed plantation-forestry systems as they fix atmospheric nitrogen for sustenance and growth. Acacia catechu Willd., a leguminous tree, is used in afforestation and reclamation programmes due to its easy adaptability and rapid growth rate even on marginal soils and wastelands in the tropics [1]. Acacia arabica (Babul), a leguminous tree of tropical and sub-Saharan Africa is naturalized in many parts of peninsular India; as an economically valued timber, it is used for crafting of agricultural implements, building materials, furniture, and fuel wood as well while the leaves and pods are used for fodder; gum arabica has many industrial applications. This species has great ecological value in controlling erosion and improving soil fertility. Hardwickia binata Roxb. is a leguminous tree found in the dry savannah forests of the Deccan peninsula and central India. It grows up to 36.5 m in height and 4.5 m in girth with a 12–15 m clean cylindrical bole. It is one of the most economically important Indian timber trees and is used for construction and ornamental wood work. Its bark is used for tanning, fiber, and paper, its resin is a wood preservative, and its leaves can be used as fodder and manure. Dalbergia sissoo, an important and valuable leguminous tree species, has been used for ages for various purposes. Leguminous plants are difficult to propagate. Propagation through seed is unreliable as mature seeds are often damaged by pod borers followed by bacteria and fungi which cause secondary infections; healthy seeds are rarely available for mass propagation. Poor germination and death of young seedlings are also the causes of worry. Mass cloning via somatic embryogenesis can be an alternative and reliable system for plant multiplication [2]. Somatic embryogenesis was reported for a number of dicotyledonous and monocotyledonous angiosperms but fewer woody species [2–4]. Woody species were recalcitrant to in vitro culture and regeneration and most of those reports focused on propagation or multiplication through organogenesis using various explants. Very meager information on somatic embryogenesis in leguminous tree species was available. It was thought that plants must coordinate the growth of root and shoot meristems to maintain an appropriate balance of root and shoot organs, respond and adapt to various environmental conditions to achieve an intermeristems coordination of growth and development involving the interplay of several long-range signals [5, 6]. The objectives of this study were to investigate the requirements of culture media, including environmental conditions for induction of somatic embryogenesis, maturation, and germination of the embryos in some important leguminous tree species.
2. Materials and Methods2.1. Plant Material
Immature green pods of Acacia arabica, Acacia catechu, Hardwickia binata, and Dalbergia sissoo (60 days after flowering) were collected from elite trees growing in dry deciduous forests. The pods were washed with 2% (w/v) detergent solution (Teepol) for 10 min, further ringed with 70% ethanol for 1 min, surface sterilized with 0.1% (w/v) aqueous solution of mercuric chloride for 15 minutes, followed by three 5-minute rinses in sterile distilled water. Embryonic axis along with cotyledons were aseptically cultured on Murashige and Skoog [7] medium supplemented with various concentrations of BA or Kn (0, 0.25, 0.5, 1.0, 1.5, 2.0 mg/l), NAA or 2, 4-D (0, 0.5, 1.0, 1.5, 2.0, 3.0 mg/l) alone or in combinations for callus induction. The pH of the media was adjusted to 5.7 using 0.1 N NaOH or 0.1 N HCl prior to addition of 0.8% (w/v) agar (Qualigen, India). Routinely, 20 ml of molten medium was dispensed into 25 × 150 mm glass tubes (Borosil, India), capped with nonabsorbent cotton plugs and wrapped in one layer of cheesecloth. The cultures were sterilized at 121°C and 104 kPa for 15 minutes.
2.1.1. Induction of Somatic Embryogenesis
Callus pieces (500 ± 20 mg) were transferred to MS medium supplemented with different concentrations of BA, kinetin, and 2,4-D or NAA (0, 0.25, 0.5, 1.0, 1.5, 2.0, 2.5 and 3.0 mg/l) singly or in combinations for induction of somatic embryogenesis. The cultures were incubated under 16h photoperiod with light intensity of 55 μmolm−2s−1 provided by cool, white fluorescent lamps (Phillips, India) at 25 ± 2°C. Morphological changes were recorded through visual observations at 3-week intervals. L-proline was added to the culture medium to enhance the embryogenic potential. The media were solidified with 0.8% agar-agar. Subculturing was made every 4-week intervals. The embryogenic response and number of somatic embryos per culture were recorded.
3. Germination of Somatic Embryos
The embryogenic callus was transferred to various culture media with or without growth regulators for maturation and germination. The medium was supplemented with 0.1–0.25 mg/l IAA or IBA and 2% sucrose for maturation and germination of somatic embryos, 5–10 mg/l ascorbic acid was added alone or in combinations for better response. The cultures were regularly subcultured at 4-week intervals. After 4 weeks of culture, germination of normal embryos was recorded. In another experiment, the cultures were kept in the dark for 2 weeks, which were then transferred to the light for germination of somatic embryos. In all the experiments, each treatment consisted of three replications, and the experiments were repeated twice. In some cases, somatic embryos lacked proper root system; the shoots were transferred to 1/2 MS medium supplemented with 2% sucrose and IBA (0.1–0.25 mg/l) for root induction.
The flow chart of the pathway of induction and germination of somatic embryos is indicated in Figure 1.
4. Results and Discussion
Friable calli developed from immature zygotic embryos within 3-4 weeks of culture on MS medium supplemented with various concentrations of auxins and cytokinins. The maximum proliferation of callus was noted in the medium containing kinetin, and 2,4-D. Kinetin was more responsive to callus induction as compared to BA. BA with NAA in the medium was also not very responsive to callus proliferation. The proliferated calli were subsequently subcultured on various media for induction of embryogenesis. Embryogenic calli developed on MS medium supplemented with 0.25–1.5 mg/l kinetin and 2.0-3.0 mg/l 2,4-D. The medium devoid of growth regulators did not promote proliferation of embryogenic calli. The maximum rate of callus proliferation was noted on MS medium supplemented with 0.25–1.5 mg/l kinetin and 2.0 mg/l 2,4-D in Dalbergia sissoo and 1.5–2.0 mg/l kinetin and 1.5–2.0 mg/l 2,4-D or NAA in Acacia arabica, Acacia catechu (Figure 2(a)), and Hardwickia binata (Table 1). Proliferation of friable embryogenic calli was better in the medium having kinetin as compared to BA in terms of fresh weight. Similar responses were observed when NAA was replaced with 2,4-D. Kinetin at a concentration of 1.0 mg/l along with 2.0 mg/l 2,4-D improved the rate of embryogenic callus proliferation and in the production of large number of somatic embryos per culture; 2,4-D though helped in the proliferation of embryogenic callus as good as the NAA, few somatic embryos developed (Table 2). However, embryogenic callus induction was faster in the medium containing 2,4-D as compared to the media having NAA. Embryo development from somatic cells was often accompanied with cellular stress. Moreover, 2,4-D, the most frequently used compound for induction of somatic embryogenesis, is known to activate many stress-related genes supporting the hypothesis that somatic embryogenesis results due to extreme stress response of cultured cells. Proline acts as a potential antioxidant, which helps in ameliorating the stress. Globular embryos developed into heart and torpedo shaped embryos faster in media containing 2,4-D and kinetin (Figures 2(b) and 2(c)). In woody species, explants from immature seeds or young seedlings generally exhibited greater ability for somatic embryogenesis than mature tissues [8]. The developmental pathway of induction of somatic embryogenesis in Acacia Arabica, Hardwickia binata, and Dalbergia sissoo are indicated in Figures 3, 4, and 5.
The somatic embryos under different treatments were counted. The medium having 1.0 mg/l NAA and 0.25 mg/l Kn produced the maximum number of somatic embryos (52.4 per culture) in Dalbergia sissoo. Although 2.0-3.0 mg/l 2,4-D in combination with 1.0 mg/l kinetin helped in the induction of large number of somatic embryos, browning of the embryos was observed; MS medium containing 2,4-D was better for maintenance of embryogenic cultures. In other species, more number of somatic embryos were produced in the medium supplemented with 2.0 mg/l 2,4-D and 1.0 mg/l Kn and the maximum proliferation of somatic embryos per 500 mg of callus were noted in Table 2. Inclusion of L-proline in the induction medium enhanced proliferation of embryogenic calli. Stimulation of auxin induced somatic embryogenesis in presence of proline has been well documented [9]. Free proline might act as an osmoticum, a nitrogen storage pool and source of NADP+, necessary for rapidly growing embryos. The mediation of the cellular redox potential that results from proline accumulation is likely to have a significant effect on the flux through redox-sensitive biochemical pathways like pentose phosphate pathway [10].
5. Germination of Somatic Embryos
Both globular and cotyledonary somatic embryos developed on MS medium supplemented with 0.1 mg/l IAA in combination with 0.1 mg/l BA (Figure 2(d)). Subsequently, the cotyledonary embryos were maintained in 1/2 strength MS medium along with 0.1 mg/l IAA, 0.1 mg/l BA to promote the development of plumule and radicle simultaneously (Figures 2(e) and 2(f)). In some cases, high percentage of cotyledonary embryos were recovered when 10 mg/l ascorbic acid was added to the medium. Ascorbic acid was an important metabolite involved in many cellular processes, including cell division, and large amount of ascorbate was utilized during initial stages of germination by both zygotic and somatic embryos. Ascorbate also acted as antioxidant and prevented tissue browning by alleviating oxidative stress. In white spruce, ascorbate in germination media increased the conversion frequency of somatic embryos [11]. Although there were high rate of embryo development, abnormalities in the somatic embryos were also frequently observed which consisted of globular embryos, secondary somatic embryos, and callus formation at the root pole. Generally, the somatic embryos produced shoot and root simultaneously. However, in some plant species, somatic embryos produced only shoots without roots [12]. Root initiation in embryo-derived shoots were achieved in IBA-containing medium. The rooted plantlets were established in the climate-controlled greenhouse.
AnonymousThe Wealth of India: A Dictionary of Indian Raw Material and industrial Products19851: ANew Delhi, IndiaCSIR3747AmmiratoPVThe regulation of somatic embryo development in plant cell cultures: suspension culture techniques and hormone requirementsNature Biotechnology198316874MaheswaranGWilliamsEGDirect secondary somatic embryogenesis from immature sexual embryos of Trifolium repens cultured in vitroAnnals of Botany1986572109117BonneauLBeranger-NovatNMoninJSomatic embryogenesis and plant regeneration in a woody species: the European spindle tree (Euonymus europaeus L.)Plant Cell Reports1994133-4135138JiangQGresshoffPMShoot control of hypernodulation and aberrant root formation in the har1-1 mutant of Lotus japonicusFunctional Plant Biology2002291113711376SearleIRMenAELaniyaTSLong-distance signaling in nodulation directed by a CLAVATA1-like receptor kinaseScience2003299560310911212411574MurashigeTSkoogFA revised medium for rapid growth and bioassay with tobacco tissue culturesPlant Physiology196215473497MottRLCongerBVTreeCloning Agricultural Plants via In Vitro Techniques1981Boca Raton, Fla, USACRC Press217256ShettyKMcKersieBDProline, thioproline and potassium mediated stimulation of somatic embryogenesis in alfalfa (Medicago sativa L.)Plant Science1993882185193GhantiSKSujataKGRaoSUdayakumarMKavi KishorPBRole of enzymes and identification of stage-specific proteins in developing somatic embryos of chickpea (Cicer arietinum L.)In Vitro Cellular and Developmental Biology2009456667672StasollaCLamMSWYeungECExogenous applications of ascorbic acid enhance shoot apical meristem growth and induce shoot organogenesis in germinating white spruce (Picea glauca) somatic embryosInternational Journal of Plant Sciences20061673429436Te-chatoSNualsriCKanchanapoomKSomatic embryogenesis of oil palm (Elaeis guineensis Jacq.) subsequent to plantlet regenerationMicrobial Utilization of Renewable Resources1988699104
Flow chart of in vitro somatic embryogenesis in A.catechu.
In Vitro somatic embryogenesis of Acacia catechu. (a) Development of embryogenic callus from immature zygotic embryos on MS medium +1.5 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of culture. (b, c) Secondary somatic embryogenesis on medium having 1.5 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of subculture. (d) Globular and torpedo-shaped somatic embryos. (e) Germination of somatic embryos on 1/2 strength MS medium supplemented with 0.1 mg/l IAA, 0.25 mg/l BA and 2% sucrose after 2 weeks of culture. (f) Somatic embryo germinated into plantlet with cotyledons and plumule.
In Vitro somatic embryogenesis in Acacia Arabica. (a) Development of embryogenic callus from immature zygotic embryos on MS medium +1.5 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of culture. (b) Secondary somatic embryogenesis on medium having 1.5 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of subculture. (c, d) Torpedo shaped somatic embryos. (e) Somatic embryo derived plantlets on 1/2 strength MS medium supplemented with 0.25 mg/l BA and 2% sucrose after 3 weeks of culture.
In Vitro somatic embryogenesis in Hardwickia binata. (a) Development of embryogenic callus from immature zygotic embryos on MS medium + 1.0 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of culture. (b, c) Secondary somatic embryogenesis on medium having 1.0 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of subculture. (d) Globular and torpedo shaped somatic embryos germinating on 1/2 strength MS medium supplemented with 0.1 mg/l IAA, 0.25 mg/l BA and 2% sucrose after 2 weeks of culture.
In Vitro somatic embryogenesis in Dalbergia sissoo. (a) Development of embryogenic callus from immature zygotic embryos on MS medium + 1.0 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of culture. (b) Primary and secondary somatic embryogenesis on medium having 1.0 mg/l Kn, 2.0 mg/l 2,4-D after 4 weeks of subculture. (c) Scanning Electron Microscopy (SEM) of globular embryos. (d) Globular somatic embryos. (e) SEM of germination of somatic embryos on 1/2 strength MS medium supplemented with 0.1 mg/l IAA, 0. 25 mg/l BA and 2% sucrose after 2 weeks of culture. (f) Somatic embryos with cotyledons and radicle.
Effect of cytokinins and auxins on induction of embryogenic callus from immature zygotic embryos of Dalbergia sissoo (DS), Acacia catechu (AC), Acacia arabica (AA), and Hardwickia binata (HB).
MS + growth regulator (mg/l)
Percent of explant response (Mean ± SE)*
BA
Kn
NAA
2,4-D
DS
AC
AA
HB
0
0.25
0.5
0
20.4 ± 0.6 (NE)
18.6 ± 0.7 (NE)
31.2 ± 0.6 (NE)
29.4 ± 0.6 (NE)
0
0.25
1.0
0
24.2 ± 0.8 (NE)
28.8 ± 0.6 (NE)
36.4 ± 0.7 (NE)
32.2 ± 0.8 (NE)
0
0.25
2.0
0
54.8 ± 0.7 (NE)
42.4 ± 0.7 (E)
42.8 ± 0.6 (E)
45.6 ± 0.7(NE)
0
0.5
2.0
0
62.4 ± 0.8 (NE)
50.6 ± 0.8 (E)
46.6 ± 0.8 (E)
50.2 ± 0.8(NE)
0
0.5
3.0
0
72.8 ± 0.6 (NE)
62.5 ± 0.6 (E)
58.8 ± 0.7 (E)
60.2 ± 0.6(NE)
0.25
0
1.0
0
26.2 ± 0.7 (NE)
30.4 ± 0.9 (NE)
28.7 ± 0.9 (NE)
34.4 ± 0.9 (NE)
0.50
0
2.0
0
34.6 ± 0.8 (NE)
44.3 ± 0.6 (NE)
46.2 ± 0.7 (NE)
52.1 ± 1.0 (NE)
1.00
0
3.0
0
54.2 ± 0.7 (NE)
61.6 ± 0.8 (NE)
56.4 ± 0.6 (NE)
56.6 ± 0.4 (NE)
0
0.25
0
1.0
32.8 ± 0.9 (E)
42.2 ± 0.7 (E)
46.9 ± 0.2 (E)
52.6 ± 0.8 (E)
0
0.25
0
2.0
45.8 ± 0.6 (E)
56.7 ± 0.8 (E)
62.2 ± 0.5 (E)
66.2 ± 0.9 (E)
0
0.5
0
3.0
68.8 ± 0.8 (E)
60.4 ± 1.0 (E)
72.5 ± 0.7 (E)
78.4 ± 0.8 (E)
0
1.0
0
2.0
75.2 ± 0.6 (E)
58.8 ± 0.7 (E)
64.4 ± 0.8 (E)
66.2 ± 0.7 (E)
0
1.5
0
2.0
76.2 ± 0.8 (E)
66.2 ± 1.1 (E)
72.3 ± 0.7 (E)
76.6 ± 1.0 (E)
0.25
0
0
2.0
56.6 ± 0.7(NE)
45.6 ± 0.8(NE)
52.5 ± 0.6(NE)
56.9 ± 1.1(NE)
0.50
0
0
3.0
64.4 ± 0.6 (NE)
54.2 ± 1.0 (NE)
58.2 ± 0.5 (NE)
68.4 ± 0.5 (NE)e
*20 Replicates per culture; repeated thrice. NE—Non-embryogenic Calli, E—Embryogenic Calli.
Development of different sizes of somatic embryos from embryogenic callus of Dalbergia sissoo (DS), Acacia catechu (AC), Acacia arabica (AA), and Hardwickia binata (HB) cultured on different induction medium after 4 weeks of subculture.
Culture medium + 3% (w/v) sucrose
No of somatic embryos per 500 mg embryogenic calli (Mean ± SE)*
*Data collected after four weeks of culture on proliferation medium.
oai:pubmedcentral.nih.gov:30426832011-02-24btripmc-openBiotechnol Res IntBTRIBiotechnology Research International2090-3146SAGE-Hindawi Access to Research30426832135066810.4061/2011/810425Research ArticleOptimization for the Production of Cellulase Enzyme from Municipal Solid Waste Residue by Two Novel Cellulolytic FungiGautamS. P.1BundelaP. S.2PandeyA. K.3KhanJamaluddin4AwasthiM. K.2SarsaiyaS.2*1Central Pollution Control Board, New Delhi, India2Regional Office, M. P. Pollution Control Board, Vijay Nagar, Jabalpur, Madhya Pradesh, India3Mycological Research Laboratory, Department of Biological Sciences, Rani Durgavati University, Jabalpur, Madhya Pradesh, India4Yeast and Mycorrhiza Biotechnology Laboratory, Department of Biological Sciences, Rani Durgavati University, Jabalpur, Madhya Pradesh, India*S. Sarsaiya: surendra_sarsaiya@yahoo.co.in
The main purpose of this study is to reduce the production cost of cellulase by optimizing the production medium and using an alternative carbon source such as municipal solid waste residue. In the present investigation, we aim to isolate the two novel cellulase producing fungi (Aspergillus niger and Trichoderma sp.) from municipal solid waste. Municipal solid waste residue (4-5% (w/v)) and peptone and yeast extract (1.0% (w/v)) were found to be the best combination of carbon and nitrogen sources for the production of cellulase by A. niger and Trichoderma sp. Optimum temperature and pH of the medium for the cellulase production by A. niger were 40°C and 6-7, whereas those for the production of cellulase by Trichoderma sp. were 45°C and 6.5. Cellulase production from A. niger and Trichoderma sp. can be an advantage as the enzyme production rate is normally higher as compared to other fungi.
1. Introduction
Ethanol production from municipal solid waste biomass is emerging as one of the most important technologies for sustainable fuels. major constrains in enzymatic hydrolysis of cellulosic materials for the production of fermentation sugar are low productivity and the cost of cellulases [1]. Municipal solid waste (MSW) is the largest group of waste present on this planate causing environmental pollutions [2]. It was estimated that the photosynthetic material annually with respect to carbon of which about 50% is cellulose. It is a fibrous, insoluble, high molecular weight, crystalline polysaccharides composted of repeating D-glucose units linked by β-1,4-glucosidic bonds and being the most abundant carbohydrate polymer on earth [3, 4]. Cellulases are consortium of free enzymes which comprise of endoglucanases (β-1, 4-D-glucan-4-glucanohydrolase, EC 3.2.1.4, carboxymethyl cellulase, EC), exoglucanases (β-1,4-D-glucan-4-glucohydrolase, EC 3.2.1.91, cellobiohydrolase, CBH), and cellobiases (β-D-glucoside glucohydrolase, EC 3.2.1.21, β-1,4-D-glucosidase) which are found in many of the 57 glycosyl hydrolase families [5]. The right proportion of these enzyme acts synergistically for maximum saccharification. Endoglucanase cleaves internal β-1,4-glucan chain links in cellulose randomly [6] and opens the molecules for cellobiohydrolases which hydrolyze the bonds at nonreducing end of crystalline cellulosic chain producing cellobiose cellobiases which split the disaccharide units and convert cellobiose into glucose and thus complete the cellulolysis [7]. MSW containing organic substances is an ideal habitat for different species of fungi. Cellulolytic fungi isolated from this source have been used to convert cellulosic materials into valuable compounds such as ethanol and organic acid. Some of these fungi are mesophiles whereas others are thermotolerant. Usually the thermotolerant elaborate enzymes are more active at high temperature and more thermostable than enzymes produced by their mesophilic counterparts. The biological degradation of cellulose has a great importance in the activity of living system. Many cellulolytic waste products which otherwise are inedible not potable for human consumption are converted into useful products by the aid of microorganisms. Cellulolytic organism can convert cellulose in various economically important products and monomeric sugars [8, 9], single cell protein [10], antibiotics [11], and compost [12] to every day use for man. Utilization of cellulosic material is thought in recent years to contribute to the production of food and energy [13].
Microbial enzymes have the enormous advantage of being able to be produced in large quantities by established fermentation techniques. Enzyme production is closely controlled in microorganisms and therefore, to improve its productivity these controls can be exploited and modified. Cellulase yields appear to depend on a complex relationship involving a variety of factors like pH, temperature, incubation period, cations, carbon, and nitrogen sources [14, 15]. To establish a successful fermentation process, it is necessary to make the microorganism for overproduction of the desired metabolite. An elaborate investigation is therefore, required to establish the optimum condition to scale up enzyme production in an individual fermentation process. Several researchers have shown that the production costs of cellulase are tightly associated with the productivity of enzyme producing microbial strains [16–19]. Such process would help alleviate shortages of food and animal feeds, solve modern waste disposal problem, and diminish man's dependence on fossil fuels by providing a convenient and renewable source of energy in the form of glucose which can be used for the production of ethanol, organic acids, and other chemicals [20].
In this investigation, a cellulase producing strain of A. niger and Trichoderma sp., isolated from municipal solid waste, were subjected to optimization of media and cultivation parameters for cellulase production.
2. Materials and Methods2.1. Collection of Sample
Municipal solid waste samples were collected from different localities of Jabalpur. It was taken by means of sterilized spatulas and collected in sterile polythene bags. The samples were then brought to the laboratory for Microbiological study.
2.2. Isolation of Fungi
Municipal solid waste was collected for the isolation of fungi. One gram was transferred to aliquots of 9 mL sterile distilled water in test tube. It was shaken vigorously at constant speed for 15 min. The MSW suspension was then subjected to serial dilutions from the appropriate plate in duplicate. The plates were incubated for 5 days at 28°C. The well-grown spreaded single colonies were picked up and subcultured on potato dextrose agar slants.
2.3. Screening for Cellulase Enzyme
Municipal solid waste associated fungi were tested for their ability to produce the hydrolytic enzymes: cellulase in a plate assay method using 1% carboxymethyl cellulose in a basal salt media, respectively, according to [21] at the incubation period, 0.1% congo red solution was added and counterstained with 1 M NaCl for 15–20 min. The zone of cellulose hydrolysis was appeared as a clear area around the colony.
2.4. Production of Cellulase Enzyme
Strains presenting large clearing zones in congo red test were used for enzyme production on basal salt medium containing 1% cellulose as a sole carbon source [22]. Stationary state technique was used and 150 mL Erlenmeyer flask filled with 50 mL of the medium. Each flask was inoculated with two discs (7 mm diameters) cut from the periphery of 4-day-old culture of Aspergillus niger and Trichoderma sp. actively growing on PDA plates. The flasks were then incubated at 30°C in stationary state.
2.5. Enzyme Assay
Filter paper activity (FPase) for total cellulase activity in the culture filtrate was determined according to the standard method [21]. Aliquots of appropriately diluted cultured filtrate as enzyme source were added to whatman no. 1 filter paper strip (1 × 6 cm; 50 mg) immersed in one milliliter of 0.05 M Sodium citrate buffer of pH 5.0. After incubation at 50 ± 2°C for 1 hr, the reducing sugar released was estimated by dinitrosalicylic acid (DNS) method [23]. One unit of filter paper (FPU) activity was defined as the amount of enzyme releasing 1 μmole of reducing sugar from filter paper per ml per min. Endoglucanase activity (CMCase) was measured using a reaction mixture containing 1 mL of 1% carboxymethyl cellulose (CMC) in 0.5 M citrate acetate buffer (pH 5.0) and aliquots of suitably diluted filtrate. The reaction mixture was incubated at 50 ± 2°C for 1 h, and the reducing sugar produced was determined by DNS method. β-glucosidase activity was assayed by the method of [24]. One unit (IU) of endoglucanase activity was defined as the amount of enzyme releasing 1 μmole of reducing sugar per min.
2.6. Optimization of Culture Conditions for Enzyme Production2.6.1. Effect of pH on Enzyme Production
To determine optimal pH, A. niger and Trichoderma sp. were cultivated in a 150 mL flask containing 50 mL optimized medium with different pH ranges from 3.0 to 9.0. The pH of the medium was adjusted by using 1 N HCl or 1 N NaOH. The flasks were kept in stationary stage at 37°C for 5 days of cultivation.
2.6.2. Effect of Temperature on Enzyme Production
In order to determine the effective temperature for cellulase production by the A. niger and Trichoderma sp., fermentation was carried out at 10°C intervals in the range of 20 to 80 ± 2°C.
2.6.3. Effect of Incubation Period on Enzyme Production
Fermentation period was an important parameter for enzyme production by A. niger and Trichoderma sp. In this study, fermentation experiment was carried out up to 7 days and production rate was measured at 24 h intervals.
2.6.4. Effect of Carbon Sources on Enzyme Production
Effects of various carbon compounds namely, cellulose, CMC, glucose, sucrose, and maltose were used for studying. The broth was distributed into different flasks and 0.5 to 3.0% of each carbon sources were then added before inoculation of the strain and after culture inoculation, the flasks were incubated for 5 days at 45 ± 2°C.
2.6.5. Effect of Nitrogen Sources on Enzyme Production
In the present study, we aim to detect the appropriate nitrogen source for cellulase production by the A. niger and Trichoderma sp. The fermentation medium was supplemented with organic and inorganic compounds (peptone, beef extract, ammonium nitrate, sodium nitrate, and yeast extract) at 0.5 to 3.0% level, replacing the prescribed nitrogen source of the fermentation medium.
2.6.6. Effect of Municipal Solid Waste Residue on Enzyme Production
In the present study, we aim to determine the appropriate concentration of municipal solid waste residue for cellulase production by the A. niger and Trichoderma sp. The fermentation medium was supplemented with municipal solid waste residue at 1.0 to 6.0% level, replacing the prescribed carbon source of the fermentation medium.
2.7. Statistical Analysis
Data presented on the average of three replicates (±SE) are obtained from there independent experiments.
3. Results and Discussion3.1. Screening of Fungi for Cellulase Activity
Screenings of fungi for their cellulase activity were carried out by the hydrolysis of substrate incorporating in the basal salt medium. After an incubation period, enzyme activities were detected by the appearance of zones either by substrate clearances or coloration and discoloration around the fungal colonies. A. niger and Trichoderma sp. were showed the highest zone around the colony, used for further study.
3.2. Optimization of Culture Conditions for Enzyme Production3.2.1. Effect of pH on Enzyme Production
There exists a strong influence of initial pH of the medium on enzyme production. To evaluate the effects of pH value in substrate on cellulase synthesis, the pH values were adjusted by the addition of HCl or NaOH to 3.0, 4.0, 5.0, 7.0, 8.0, and 9.0. The results shown in Figures 1 and 5 showed that the production of exoglucanase (1.76 & 2.16 U/mL), endoglucanase (1.25 & 1.94 U/mL), and β-glucosidase (1.44 & 1.71 U/mL) by A. niger and Trichoderma sp. was found between 6-7 and 5-6 pH. The optimum pHs for cellulase activity were found at pH 6.5. The enzyme activity gradually increased when increasing the pH up to the optimum followed by a gradual full in activity. It was also noted that the enzyme activity was stable at pH range of 5.0–8.0. Effect of pH on cellulase production by these fungi supports the findings of [25] who reported that CMCase, Avicelase, and FPase activities exhibit a pH optimum of approximately 4, while the pH optimum of β-glucosidase was between pH 5-6.
3.2.2. Effect of Temperature on Enzyme Production
The effect of temperature on cellulase activity was determined by incubating the flask at a range of temperature of 20, 30, 40, 50, 60, 70, and 80°C. The results of the test made at different temperatures value showed that the optimal temperature for exoglucanase (1.95 U/mL) and endoglucanase activity (1.88 U/mL) produced by A. niger was between 40 and 50°C (Figure 2), while the optimum temperature for β-glucosidase activity (1.98 U/mL) between 45 and 55°C. Due to high temperature (above 65°C), the results showed that the enzyme activity was decreased when the temperature increased above 65°C. However, maximum enzyme production by Trichoderma sp. was found to be 1.95 U/mL exoglucanase, 1.88 U/mL endoglucanase and 1.88 β-glucosidase activity between 40–50°C (Figure 6). Many workers have reported different temperatures for maximum cellulase production either in flask or in fermentor studies using Aspergillus sp. and Trichoderma sp. suggesting that the optimal temperature for cellulase production also depends on the strain variation of the microorganism [26, 27].
3.2.3. Effect of Incubation Period on Enzyme Production
Aspergillus niger was inoculated into basal salt medium in 150 mL conical flask and incubated at 45 ± 2°C for a period of 7 days. The cellulase activity was measured at regular intervals. However, the maximum yield of exoglucanase (1.64 U/mL) and endoglucanase (1.84 U/mL) activity was obtained after 4 days. However, maximum β-glucosidase (1.61 U/mL) activity was shown after 3–5 days incubation in Figures 3 and 7. To determine the optimum incubation period for enzyme production by Trichoderma sp., the highest amount of glucose was recorded on 5th day. The incubation period is directly related to the production of enzyme and other metabolic up to a certain extent. A. niger and Trichoderma sp. showed the most active cellulolytic species along different incubation period. The incubation periods to achieve peak cellulase activity by the isolate A. niger and Trichoderma sp. were 4th and 6th days which was suitable for commercial point of view [28]. It might be due to the depletion of nutrients in the medium which stressed the fungal physiology resulting in the inactivation of secretary machinery of the enzymes [29].
3.2.4. Effect of Carbon Sources on Enzyme Production
Carbon sources play a vital role in the cell metabolism and synthesis of cellulase. The effect of carbon sources on the production of enzyme by A. niger and Trichoderma sp. was investigated. Carbon sources tested for production of cellulase enzyme by A. niger were glucose, sucrose, cellulose, carboxymethyl cellulose, and maltose ranging from 0.5 to 3.0% (w/v). Cellulose and CMC were found to be the best carbon sources for enzyme production by A. niger as shown in Table 1. However, the maximum production of exoglucanase (1.97 U/mL), endoglucanase (1.67 U/mL), and β-glucosidase (2.31 U/mL) was obtained in culture containing 1.0% cellulose. Among the different carbon sources used, the CMC was the second best carbon source (1.0%) for cellulase production by A. niger followed by sucrose, glucose, and maltose (Table 1), while sucrose (1.0%) was found to be the best carbon for cellulase production (exoglucanase (2.68 U/mL), endoglucanase (2.17 U/mL) and β-glucosidase (2.06 U/mL)) by Trichoderma sp. followed by glucose, cellulose maltose, and CMC. Cellulase production increased with increases in initial sugar concentration from 1.0 to 1.5% (Table 3) while further increases in sugar concentration slightly reduced the yield. Cellulase production increased with increases in initial sugar concentration from 1.0 to 1.5%, while further increases in sugar concentration slightly reduced the yield. Reference [30] also reported that maximum yields of cellulase were obtained on 1% different carbon substrate using T. viride. Cellulase production commended on reaching nitrogen-limiting conditions and the yield of cellulase decreased when excess peptone was presented; various inorganic nitrogen sources have been optimized by different workers for cellulase production [22, 31].
3.2.5. Effect of Nitrogen Sources on Enzyme Production
The effect of different nitrogen sources on the production of cellulase enzyme by A. niger and Trichoderma sp. was investigated. The nitrogen sources tested ranged from 0.5 to 3.0% (w/v) peptone, beef extract, yeast extract, ammonium nitrate, and sodium nitrate. The results in Table 2 showed that a concentration of 1.0% peptone, beef extract, and yeast extract led to maximum production of cellulase enzyme. Among different nitrogen sources, the highest cellulase production (exoglucanase (1.78 U/mL), endoglucanase (1.44 U/mL), and β-glucosidase (1.97 U/mL)) was reported from 1.0% peptone and production decreased significantly below and above this concentration by A. niger. Peptone produced maximum cellulase followed by ammonium nitrate and beef extract while yeast extract and sodium nitrate produced almost same, lesser, quantity of cellulase by A. niger while nitrogen sources had a marked effect on enzyme produced by Trichoderma sp. The maximum enzyme activities were obtained with yeast extract (1.0%) which brought about an improvement in all the three cellulase components, including exoglucanase (2.40 U/mL), endoglucanase (2.28 U/mL), and β-glucosidase (1.99 U/mL), where peptone also produces the second most cellulase producing nitrogen source by Trichoderma sp. (Table 4). It was reported that good cellulase yield can be obtained with ammonium compound as the nitrogen source. Though the addition of organic nitrogen sources such as beef extract and peptone resulted in increased growth and enzyme production, as was reported before, they were not an effective replacement for inorganic nitrogen sources because of their higher cost [32].
3.2.6. Effect of Municipal Solid Waste Residue in Enzyme Production
In the present investigation, municipal solid waste residue was used as a cheap and easily available carbon source for cellulase enzyme production. The results revealed that MSW residue (4.0%) was the best carbon substrate for exoglucanase (1.19 U/mL), endoglucanase (1.504 U/mL), and β-glucosidase (1.39 U/mL) by A. niger as shown in Figure 4, while in case of Trichoderma sp. 4.0% MSW residue was best for cellulase (exoglucanase (1.77 U/mL), endoglucanase (1.95 U/mL), and β-glucosidase (1.66 U/mL)) enzyme production (Figure 8). These results were confirmed by the results of [33]. This variation may be attributed to the chemical nature and nutrient availability of the used substrates.
4. Conclusions
In this investigation, the culturing of A. niger and Trichoderma sp. proved to be an excellent source for the enzymes production. In the present study, these cultures produced an amount of enzyme 40 to 60% higher than other fungi. Municipal solid waste in the form of cellulose which is the most abundant renewable biomass in the biosphere has been shown to be used in the production of valuable products by A. niger and Trichoderma sp. Municipal solid waste residue could provide an economical advantage as a solid substrate as well as a carbon source for production of cellulase enzyme by using fungus strain, A. niger and Trichoderma sp. Thus, a simplified medium containing municipal solid waste residue supplemented with simple salts proved to be cost effective substrate for cellulase production. Mixed culture combinations have the ability to utilize the substrates as energy sources better than highly versatile pure cultures. Further investigations are required to make use of the full potential of these organisms for cellulase production by employing genetic, biochemical, and microbial engineering techniques.
Acknowledgments
The authors are thankful to M. P. Pollution Control Board Bhopal and Head, Department of Biological Sciences, R. D. University, Jabalpur, for laboratory facilities. Ministry of Environment and Forest New Delhi is also thankfully acknowledged for financial support.
LeeBHKimBKLeeYJChungCHLeeJWIndustrial scale of optimization for the production of carboxymethylcellulase from rice bran by a marine bacterium, Bacillus subtilis subsp. subtilis A-53Enzyme and Microbial Technology20104613842RaniDSNandKProduction of thermostable cellulase-free xylanase by Clostridium absonum CFR-702Process Biochemistry2000364355362JagtapSRaoMPurification and properties of a low molecular weight 1,4-β-D-glucan glucohydrolase having one active site for carboxymethyl cellulose and xylan from an alkalothermophilic Thermomonospora spBiochemical and Biophysical Research Communications2005329111111615721281GuoRDingMZhangSLXuGJZhaoFKMolecular cloning and characterization of two novel cellulase genes from the mollusc Ampullaria crosseanJournal of Comparative Physiology B20081782209215SiddiquiKSSaqibAANRashidMHRajokaMICarboxyl group modification significantly altered the kinetic properties of purified carboxymethylcellulase from Aspergillus nigerEnzyme and Microbial Technology200027746747410978768SchüleinMProtein engineering of cellulasesBiochimica et Biophysica Acta20001543223925211150609DuenasRTengerdyRPGutierrez-CorreaMCellulase production by mixed fungi in solid-substrate fermentation of bagasseWorld Journal of Microbiology and Biotechnology1995113333337BisariaVSGhoseTKBiodegradation of cellulosic materials: substrates, microorganisms, enzymes and productsEnzyme and Microbial Technology19813290104LinkoMAn evolution of enzymatic hydrolysis of cellulosic materialsAdvances in Biochemical Engineering197752541UpdegraffDMUtilization of cellulose from waste paper by Myrothecium verrucariaBiotechnology and Bioengineering197113177975546592ven HofstenBMicrobial Conversion of Cellulosic Waste Products Waste Recovery by Microorganism1972Kualalumpur, MalaysiaUNESCOGautamSPBundelaPSPandeyAKAwasthiMKSarsaiyaSComposting of municipal solid waste of Jabalpur CityGlobal Journal of Environmental Research201044346HampheryAEMoreiraAArmigerWZabriskieDProduction of single cell protein from cellulose wastesBiotechnology & Bioengineering Symposium197774564ImmanuelGDhanushaRPremaPPalavesamAEffect of different growth parameters on endoglucanase enzyme activity by bacteria isolated from coir retting effluents of estuarine environmentInternational Journal of Environmental Science and Technology2006312534BischoffKMRooneyAPLiXLLiuSHughesSRPurification and characterization of a family 5 endoglucanase from a moderately thermophilic strain of Bacillus licheniformisBiotechnology Letters200628211761176516900329ChahalPSChahalDSAndreGCellulase production profile of Trichoderma reesei on different cellulosic substrates at various pH levelsJournal of Fermentation and Bioengineering1992742126128DuffSJBMurrayWDBioconversion of forest products industry waste cellulosics to fuel ethanol: a reviewBioresource Technology1996551133ReczeyKSzengyelZEklundRZacchiGCellulase production by T. reeseiBioresource Technology19965712530