<?xml version="1.0" encoding="UTF-8"?><OAI-PMH xmlns="http://www.openarchives.org/OAI/2.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.openarchives.org/OAI/2.0/ http://www.openarchives.org/OAI/2.0/OAI-PMH.xsd"><responseDate>2013-05-25T16:02:08Z</responseDate><request verb="ListRecords" from="2001-03-22" metadataPrefix="pmc" set="bmcbioc" until="2001-06-12">http://www.ncbi.nlm.nih.gov/oai/oai.cgi</request><ListRecords><record><header><identifier>oai:pubmedcentral.nih.gov:29057</identifier><datestamp>2001-03-22</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">29057</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-1-1</article-id>
      <article-id pub-id-type="pmid">11001588</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-1-1</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>DNA loops and semicatenated DNA junctions</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" corresp="yes" contrib-type="author">
          <name>
            <surname>Gaillard</surname>
            <given-names>Claire</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>gaillard@ijm.jussieu.fr</email>
        </contrib>
        <contrib id="A2" contrib-type="author">
          <name>
            <surname>Strauss</surname>
            <given-names>François</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>strauss@ijm.jussieu.fr</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Institut Jacques Monod, 2 Place Jussieu, 75251 Paris 05, France</aff>
      <pub-date pub-type="collection">
        <year>2000</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>19</day>
        <month>7</month>
        <year>2000</year>
      </pub-date>
      <volume>1</volume>
      <fpage>1</fpage>
      <lpage>1</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/1/1"/>
      <history>
        <date date-type="received">
          <day>8</day>
          <month>6</month>
          <year>2000</year>
        </date>
        <date date-type="accepted">
          <day>19</day>
          <month>7</month>
          <year>2000</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2000 Gaillard and Strauss; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2000</copyright-year>
        <copyright-holder>Gaillard and Strauss; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>Alternative DNA conformations are of particular interest as potential signals to mark important sites on the genome. The structural variability of CA microsatellites is particularly pronounced; these are repetitive poly(CA) · poly(TG) DNA sequences spread in all eukaryotic genomes as tracts of up to 60 base pairs long. Many in vitro studies have shown that the structure of poly(CA) · poly(TG) can vary markedly from the classical right handed DNA double helix and adopt diverse alternative conformations. Here we have studied the mechanism of formation and the structure of an alternative DNA structure, named Form X, which was observed previously by polyacrylamide gel electrophoresis of DNA fragments containing a tract of the CA microsatellite poly(CA) · poly(TG) but had not yet been characterized.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>Formation of Form X was found to occur upon reassociation of the strands of a DNA fragment containing a tract of poly(CA) · poly(TG), in a process strongly stimulated by the nuclear proteins HMG1 and HMG2. By inserting Form X into DNA minicircles, we show that the DNA strands do not run fully side by side but instead form a DNA knot. When present in a closed DNA molecule, Form X becomes resistant to heating to 100°C and to alkaline pH.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>Our data strongly support a model of Form X consisting in a DNA loop at the base of which the two DNA duplexes cross, with one of the strands of one duplex passing between the strands of the other duplex, and reciprocally, to form a semicatenated DNA junction also called a DNA hemicatenane.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>Alternative DNA conformations are of particular interest as potential signals to mark important sites on the genome, contrasting with the rather uniform structure of the classical B-form DNA double helix which shows little variation as a function of its nucleotide sequence. The structural variability of CA microsatellites is particularly pronounced. These are repetitive poly (CA) · poly (TG) DNA sequences spread in all eukaryotic genomes as tracts of up to 60 base pairs long, sometimes longer, which are particularly abundant in the human genome where they are present in about 10<sup>5</sup> copies [<xref ref-type="bibr" rid="B1">1</xref>]. Because of this abundance, combined with their frequent length variability between different individuals, they have served as a very useful source of markers in human genetics. Many in vitro studies have shown that the structure of poly (CA) · poly (TG) can vary markedly from the classical right-handed DNA double helix and adopt diverse conformations (for a review see e.g. [<xref ref-type="bibr" rid="B2">2</xref>] and references therein), the best known of which being left-handed Z-DNA [<xref ref-type="bibr" rid="B3">3</xref>,<xref ref-type="bibr" rid="B4">4</xref>]. In the course of our work with DNA fragments containing this repetitive sequence we have observed the formation of several alternative structures which appeared as retarded bands upon gel electrophoresis. While some of them have been shown to correspond to multistranded complexes [<xref ref-type="bibr" rid="B5">5</xref>,<xref ref-type="bibr" rid="B6">6</xref>,<xref ref-type="bibr" rid="B7">7</xref>], a series of closely spaced bands initially named 'bands X' [<xref ref-type="bibr" rid="B5">5</xref>] were drawn to our attention for two reasons. First, they migrated near the regular double-stranded form of the fragment, suggesting that they might correspond to double-stranded, not multi-stranded, structures. Second, they were bound with high affinity by proteins HMG1 and HMG2, two abundant non-histone nuclear proteins for which no double-stranded DNA substrate with such a high affinity was known. Here we describe a mechanism of formation of these structures, and their characterization as DNA loops at the base of which the DNA duplexes form a unique knot in which one of the strands of one duplex passes between the strands of the other duplex, and reciprocally, to form a semicatenated DNA junction, also called a DNA hemicatenane.</p>
    </sec>
    <sec>
      <title>Results</title>
      <p>A 120 base pair (bp) DNA fragment containing a 60 bp tract of poly(CA) · poly(TG), when incubated under specific conditions and analyzed by polyacrylamide gel electrophoresis, can give rise to a series of bands. While some of these bands have been shown to correspond to multistranded complexes [<xref ref-type="bibr" rid="B5">5</xref>,<xref ref-type="bibr" rid="B6">6</xref>,<xref ref-type="bibr" rid="B7">7</xref>], a series of closely spaced bands initially named 'Form X' [<xref ref-type="bibr" rid="B5">5</xref>] were drawn to our attention for two reasons. First, they migrated near the regular double-stranded form of the fragment, suggesting that they might correspond to double-stranded, not multi-stranded, structures. Second, they were bound with high affinity by proteins HMG1 and HMG2, two abundant non-histone nuclear proteins for which no double-stranded DNA substrate with such a high affinity was known.</p>
      <p>These bands are shown in Figure <xref ref-type="fig" rid="F1">1a</xref>, where they are noted X and migrate on this polyacrylamide gel between the two single strands of the DNA fragment. These structures are stable and can be purified by electroelution from a polyacrylamide gel ([<xref ref-type="bibr" rid="B5">5</xref>]; Fig. <xref ref-type="fig" rid="F1">1b</xref> lane 1). The study of their thermal stability (Fig. <xref ref-type="fig" rid="F1">1b</xref>) shows that they dissociate upon moderate heating to give the regular double-stranded fragment, which dissociates in turn at higher temperature to give its two single strands. Form X, therefore, contains both strands of the fragment in equimolar amount. Figure <xref ref-type="fig" rid="F1">1c</xref> shows the affinity of proteins HMG1 and HMG2 for Form X DNA. Under conditions where neither double-stranded nor single-stranded DNA is bound, Form X is entirely complexed with HMG1/2 even at a ratio of competitor DNA to Form X higher than 10<sup>6</sup>. A detailed analysis of the relative affinities of HMG1/2 to different DNA substrates (double-stranded or single-stranded DNA, loops, minicircles, cruciform, Form X) will be presented elsewhere (C.G. and F.S., in preparation).</p>
      <p>To study the detailed structure of Form X it was necessary to purify it in sufficient amounts. We have never been able to induce its formation directly, even by incubating the double-stranded fragment in the presence of a wide variety of agents or by varying the pH between 6.0 and 9.0. But, after it was shown that the formation of multistranded structures by fragments containing a tract of poly(CA) · poly(TG) was correlated to some extent with the opening of the double helix [<xref ref-type="bibr" rid="B6">6</xref>,<xref ref-type="bibr" rid="B7">7</xref>,<xref ref-type="bibr" rid="B8">8</xref>,<xref ref-type="bibr" rid="B9">9</xref>], we found that the most efficient way of producing Form X was to dissociate the DNA strands by thermal denaturation and to let them reassociate in the presence of protein HMG1 or HMG2. In this manner, we obtain the complexes of Form X with HMG1/2, which can then be dissociated by SDS and Form X purified (Fig. <xref ref-type="fig" rid="F1">1d</xref>, lane 2). In the absence of HMG1/2, this same process gives no Form X or hardly detectable amounts of Form X.</p>
      <p>To study the structure of Form X, experiments were performed to study its sensitivity to single-strand specific nucleases (S1 and P1 nucleases), and to chemicals which react specifically with non-B regions of DNA (diethylpyrocarbonate, hydroxylamine, permanganate). Such experiments (not shown) clearly showed a change of conformation limited to the repetitive region of the fragments, but did not allow us to determine its exact structure. For example, the hypothesis that Form X might correspond to four-stranded structures could not be ruled out at that stage. In addition, structures containing staggered single-stranded loops resulting from shifted reassociation in the repetitive region had to be considered [<xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B8">8</xref>]. Starting with this hypothesis, in an attempt to measure the length of such loops, we set out to determine the linking number of DNA in Form X, i.e. the number of times one strand turns around the other strand in such a structure. Indeed, if Form X contains unpaired regions, the linking number is expected to decrease by one unit for each unpaired turn of double helix (10.5 bp).</p>
      <p>To test this hypothesis, Form X obtained with a 258 bp fragment containing the same 60 bp tract of poly(CA) · poly(TG) as above was circularized, and the products obtained were compared to a series of marker topoisomers obtained by circularization of the regular linear fragment in the presence of increasing amounts of ethidium bromide [<xref ref-type="bibr" rid="B10">10</xref>]. To clearly resolve all the topoisomers, the analysis was performed on polyacrylamide gels in the absence or in the presence of chloroquine [<xref ref-type="bibr" rid="B11">11</xref>] and is shown in Figure <xref ref-type="fig" rid="F2">2</xref>. It is observed that circularized Form X (noted X<sub>c</sub>) does not migrate like any of the marker topoisomers. It can also be seen that, unlike linear Form X (X<sub>L</sub>), circular Form X is extremely stable and is not modified by incubation at 100°C (nor by alkaline pH, result not shown). Neither is it modified by incubation with calf thymus topoisomerase I or by human topoisomerase II, suggesting that it contains no superhelical stress. Since circular Form X does not correspond to any band in the series of topoisomer markers, we then considered that Form X might contain a large number of negative supercoils, larger than in the most supercoiled of the marker topoisomers, and that the corresponding torsional stress was absorbed and constrained by a change of conformation strictly limited to the poly (CA) · poly (TG) region and stabilized by supercoiling of the small circles. For example, a change of conformation from B-DNA to Z-DNA might have corresponded to this hypothesis.</p>
      <p>This was shown not to be the case when Form X was inserted in a large DNA fragment, leading to the formation of 2384 bp circles in which the linking number was measured by two-dimensional agarose gel electrophoresis, the first dimension in the absence of chloroquine and the second dimension in the presence of chloroquine [<xref ref-type="bibr" rid="B11">11</xref>] (Figure <xref ref-type="fig" rid="F3">3</xref>). No difference of migration is visible between circles containing Form X and circles containing the regular form of the fragment. If the circles containing Form X are preincubated at 100°C before electrophoresis, exactly the same distribution of topoisomers is obtained (not shown). Therefore the presence of Form X on a DNA circle of that size does not modify its electrophoretic mobility, and it is impossible to show any change of linking number in Form X relative to regular DNA. In addition, as observed with 258 bp minicircles (Fig. <xref ref-type="fig" rid="F2">2</xref>), recutting the 2384 bp circles containing Form X shows that Form X is completely stable and resistant to heating at 100°C when contained in a covalently closed circle (Fig. <xref ref-type="fig" rid="F3">3d</xref>, lanes 3 and 4). Therefore the hypothesis of a global change of conformation of poly(CA) · poly(TG) induced or stabilized by supercoiling had to be ruled out. This experiment also shows with no ambiguity that Form X contains two ends only, since ligation of Form X with the vector yields almost exclusively monomeric circles, even in the presence of an excess of vector. Therefore Form X can only be a two-stranded structure.</p>
      <p>At this stage of the work, Form X looked as a paradox: a stable non-B double stranded DNA structure, with no visible change of DNA linking number. This puzzle was resolved by ligating hairpin oligonucleotides at the ends of linear Form X. Figure <xref ref-type="fig" rid="F4">4</xref> shows that Form X remains stable in molecules with closed ends, and resists heating to 100°C and treatment by alkaline pH (lanes 4 and 5), as do circular molecules, but unlike open linear molecules. It should also be noted that upon adding a hairpin oligonucleotide at one end only, Form X is not as stable and can be dissociated by heat treatment (lane 7), although not as easily as when it is contained in an open linear fragment.</p>
      <p>These results show that both DNA strands in Form X do not simply run side by side as in regular DNA, but that they are somehow associated in a knot. A simple model appears if one considers the process used for producing Form X. During their reassociation, the two repetitive DNA strands do not necessarily pair in perfect register, but can also pair with a shift in the repetitive poly (CA) · poly (TG) region. In such a case, one should expect a pause when the reassociation process reaches the sides of the repetitive region. We suggest that during this pause one of the single strands of one end can insert in the fork formed by the two single strands at the opposite end, possibly through interactions between the short single-stranded repetitive sequences remaining on both sides of the central double-stranded region (Fig. <xref ref-type="fig" rid="F5">5</xref>). Then, complete pairing of the non repetitive sequences at both ends yields the formation of a loop at the base of which two duplexes cross, with one of the strands of one duplex passing between the two strands of the other duplex, and reciprocally, to form a structure which is schematically represented in Figure <xref ref-type="fig" rid="F5">5</xref>. Several parameters of such a structure can vary, including the location of the junction within the repetitive nucleotide sequence, the size of the loop, and the DNA linking number inside the loop. This is probably the explanation for the number of different bands shown by Form X on a polyacrylamide gel, where up to seven bands can be seen depending on the gel concentration.</p>
      <p>The role of HMG1/2 in the process of formation of Form X can be envisioned at two stages. On one hand, HMG1/2 increases the flexibility of DNA [<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B13">13</xref>] which should facilitate the formation of a loop in the central region. On the other hand, the known affinity of HMG1/2 for DNA junctions should help stabilize the transient junction before complete pairing of the non-repetitive terminal regions.</p>
      <p>The possibility that two DNA duplexes might associate to form such junctions has been proposed previously [<xref ref-type="bibr" rid="B14">14</xref>,<xref ref-type="bibr" rid="B15">15</xref>,<xref ref-type="bibr" rid="B16">16</xref>,<xref ref-type="bibr" rid="B17">17</xref>,<xref ref-type="bibr" rid="B18">18</xref>,<xref ref-type="bibr" rid="B19">19</xref>], and such structures have been termed 'hemicatenanes' to reflect the fact that each duplex is linked to the other duplex by only one of its strands, although from an etymological point of view the term 'semicatenane' formed with two Latin roots would seem more correct. We have continued to use the term 'Form X' which we used before we began to determine its structure. Semicatenanes have been considered to explain the association of meiotic chromosomes [<xref ref-type="bibr" rid="B16">16</xref>, <xref ref-type="bibr" rid="B17">17</xref>], although a double Holliday junction structure has so far been preferred. Semicatenanes have also been proposed as intermediates in the replication of the genome of SV40 virus, to explain some intermediates which seem not to correspond to fully catenated structures [<xref ref-type="bibr" rid="B15">15</xref>, <xref ref-type="bibr" rid="B18">18</xref>]. The possibility for producing such structures in vitro and their remarkable stability should now allow the study of their characteristics, which should, in turn, facilitate the investigation of their significance in vivo. It should be noted that the repetitive sequence is required only because of the particular process used to prepare Form X, but that there should be no theoretical objection to the existence of such structures with non-repetitive sequences.</p>
      <p>The remarkable stability of this structure makes it possible to consider several experiments. For example, it should be possible to insert such structures into vectors and to introduce them into living cells, allowing to study their evolution and their effect on the biological activity of the DNA molecule in which they are inserted. Equally interesting would be the study of the enzymes and more generally of the proteins able to interact with these structures. The fact that proteins HMG1 and HMG2, two of the most abundant non-histone proteins, bind to Form X with very high affinity (C.G. and F.S., in preparation) already suggests that this structure might play a role in the function of the genome. In addition, the formation of DNA loops has often been proposed to explain several chromosomal structures or many regulation processes (see e.g. [<xref ref-type="bibr" rid="B20">20</xref>,<xref ref-type="bibr" rid="B21">21</xref>]), and the semicatenated loop described here is certainly among the most stable of all DNA loops observed so far.</p>
      <fig position="float" id="F1">
        <label>Figure 1</label>
        <caption>
          <p>Formation of alternative structures by a DNA fragment containing a poly (CA) · poly (TG) tract. <bold>a.</bold> A 120 bp DNA fragment containing a 60 bp tract of poly (CA) · poly (TG) was <sup>32</sup>P end labelled and analyzed on a 4% polyacrylamide gel (lane 1). Under specific conditions of incubation [<xref ref-type="bibr" rid="B5">5</xref>,<xref ref-type="bibr" rid="B6">6</xref>,<xref ref-type="bibr" rid="B7">7</xref>,<xref ref-type="bibr" rid="B8">8</xref>] this fragment can give rise to a series of bands (lane 2). Two bands, labelled CA and TG, correspond to the single strands of the fragment. The upper ladder of bands (empty arrowheads) corresponds to multistranded forms [<xref ref-type="bibr" rid="B5">5</xref>]. Bands labelled X have not been studied previously and are the subject of the present paper, <bold>b.</bold> Form X is stable and can be electroeluted (lane 1, see Methods). After elution, Form X was incubated in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5, for 10 min. at the indicated temperatures and analyzed on a polyacrylamide gel, showing that it dissociates at ~ 50-60°C to reform the regular double-stranded fragment, <bold>c.</bold> Specific interaction of proteins HMG1 and HMG2 with Form X. The starting DNA material (lane 2) contains, in addition to the regular double-stranded fragment, small amounts of single strands and of Form X. In the presence of E. coli competitor DNA, purified HMG1 and HMG2 proteins [<xref ref-type="bibr" rid="B5">5</xref>] (lanes 1 and 3 respectively) bind exclusively to Form X. Increasing the amount of competitor DNA up to 4 μg per sample does not modify the result (not shown). <bold>d.</bold> Formation of Form X by strand reassociation in the presence of HMG1/2. The DNA fragment, labelled on its TG strand, was heat-denatured and allowed to reassociate in the presence of protein HMG1. By electrophoresis on a polyacrylamide gel, complexes between Form X and HMG1 are obtained (lane 1), and can be dissociated by SDS to yield free Form X (lane 2).</p>
        </caption>
        <graphic xlink:href="1471-2091-1-1-1"/>
      </fig>
      <fig position="float" id="F2">
        <label>Figure 2</label>
        <caption>
          <p>Circularization of Form X. In these experiments a 258 bp linear fragment containing the same 60 bp tract of poly(CA) · poly(TG) as above was used. Linear Form X (bands labelled X<sub>L</sub> lane 7, greyed arrowheads) was incubated in the presence of DNA ligase, and the circular forms obtained (bands labelled X<sub>c</sub> lanes 5 and 6, black arrowheads) were analyzed by electrophoresis on polyacrylamide gels in the absence (left panel) or in the presence (right panel) of 20 μM chloroquine. A series of marker topoisomers was prepared by ligation of the regular 258 bp linear fragment in the presence of variable amounts of ethidium bromide [<xref ref-type="bibr" rid="B10">10</xref>], yielding a series of topoisomers containing increasing numbers of negative supercoils (lanes 1-4), with up to 5 negative superturns for the most supercoiled topoisomer. In lanes 8 and 9, circularized Form X and topoisomers 0 and -1 were analyzed after incubation for 5 min. at 100°C. Note that circularized Form X does not migrate like any of the topoisomer markers.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-1-2"/>
      </fig>
      <fig position="float" id="F3">
        <label>Figure 3</label>
        <caption>
          <p>Insertion of Form X in a full length plasmid. Plasmid pE10 was cut so as to obtain two fragments, a short 120 bp fragment containing the poly (CA) · poly (TG) tract, and a large 2264 bp fragment. The small fragment was <sup>32</sup>P end labelled and part of it was converted to Form X. After reinsertion of the short fragment by ligation into the large 2264 bp fragment, the original plasmid pE10 was reconstituted either in its regular form, or as a Form X containing plasmid. To compare the linking numbers of both plasmids, they were analyzed by two dimension agarose gel electrophoresis with the first dimension without chloroquine and the second dimension in the presence of 1.3 μM chloroquine. The markers consisted of a series of topoisomers of plasmid pE10 obtained by recircularization of the linear plasmid in the presence of variable amounts of ethidium bromide. After electrophoresis, the gels were first stained with ethidium bromide and photographed to detect the markers, then dried and exposed to detect the radioactivity of the reformed plasmid. <bold>a.</bold> The experiment was performed with the 120 bp fragment in its regular linear form. <bold>b.</bold> Same experiment with Form X of the 120 bp fragment, <bold>c.</bold> Scheme of the different species present on the gels: o.c. open circles; lin. linear fragment; di. dimeric circles; +4 to -7: number of supercoils, positive or negative, in the marker topoisomers which were separated on the gel. Beyond 7 negative supercoils, all topoisomers migrate together under the conditions used. <bold>d.</bold> Analysis of the products on a 4% polyacrylamide gel, to show that Form X has remained stable after insertion in plasmid pE10. Lanes 1 and 2: pE10 containing Form X or the regular fragment, respectively. Lane 3: pE10 containing Form X was redigested with EcoRI + ClaI, the 120 bp fragment is recovered as Form X. Lane 4: pE10 containing Form X was incubated 2 min at 100°C and redigested with EcoRI + ClaI, Form X is recovered, showing that it is resistant to 100°C when inserted in a circular molecule. Lanes 5 and 6: redigestion of pE10 containing the regular linear form of the 120 bp fragment, without or with previous incubation at 100°C, respectively. The regular form of the 120 bp fragment is recovered, as expected. Lanes 7 and 8: controls showing respectively Form X and the regular 120 bp linear fragment used in these experiments.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-1-3"/>
      </fig>
      <fig position="float" id="F4">
        <label>Figure 4</label>
        <caption>
          <p>Form X on a linear fragment with closed ends. Hairpin oligonucleotides were added by ligation to the ends of purified Form X. The ligation products were gel-purified and analyzed on a polyacrylamide gel with or without preincubation at 100°C or in 0.1N NaOH. Lanes 1 and 2: linear fragment with closed ends, unincubated (lane 1) or incubated at 100°C (lane 2). Lanes 3-5: Form X with closed ends, unincubated (lane 3), incubated at 100°C (lane 4), or incubated in 0.1N NaOH (lane 5). Lanes 6 and 7: Form X with one end closed and the other end open, unincubated (lane 6) or incubated at 100°C (lane 7). It is observed that Form X with both ends closed is completely resistant to denaturation (lanes 4 and 5).</p>
        </caption>
        <graphic xlink:href="1471-2091-1-1-4"/>
      </fig>
      <fig position="float" id="F5">
        <label>Figure 5</label>
        <caption>
          <p>Model of Form X: a DNA loop with a semicatenated DNA junction. After denaturation, the reassociation of the strands of a DNA fragment containing the sequence poly (CA) · poly (TG) can occur with a shift in the repetitive sequence. In such a case, the reassociation is expected to pause when it reaches the sides of the repetitive region, allowing one of the single-stranded ends to insert into the fork formed by the two single strands at the opposite end. This process is facilitated by HMG1 or HMG2, and possibly also by the presence of complementary sequences left on both sides of the double-stranded region. The final result is a loop at the base of which two DNA duplexes cross, forming a knot in which one of the strands of one duplex passes between the two strands of the other duplex, and reciprocally, to form a semicatenated DNA junction.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-1-5"/>
      </fig>
    </sec>
    <sec>
      <title>Conclusions</title>
      <p>An alternative DNA structure named Form X, which was observed previously by polyacrylamide gel electrophoresis of DNA fragments containing a tract of the CA microsatellite poly (CA) · poly (TG) but had not been characterized, has now been identified as a DNA loop maintained at its base by a semicatenated DNA junction (Fig. <xref ref-type="fig" rid="F6">6</xref>). Structures containing DNA hemicatenanes had been previously suggested to exist in the cell but had not been isolated before. The possibility to prepare such structures, combined with their remarkable stability, should allow one to study their evolution and their possible function when introduced into living cells.</p>
      <fig position="float" id="F6">
        <label>Figure 6</label>
        <caption>
          <p>Form X: a DNA loop with a semicatenated DNA junction.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-1-6"/>
      </fig>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and Methods</title>
      <sec>
        <title>DNA fragments</title>
        <p>The DNA fragments used were from plasmid pE10, which contains a 60 bp tract of poly(CA) · poly(TG) (accession n° X96980) and were prepared by standard techniques. To close the ends of linear DNA fragments, 26 nucleotide-long synthetic hairpin oligonucleotides with appropriate ends were used.</p>
      </sec>
      <sec>
        <title>Form X</title>
        <p>To prepare Form X, DNA fragments were heat-denatured and allowed to renature in the presence of protein HMG1 or HMG2, as follows: ~ 0.1 to 10 ng of <sup>32</sup>P end labelled DNA fragment, in 5 μL of 10 mM Tris-HCl, 1 mM EDTA, pH 7.5, was denatured at 100°C for 2 min, added as quickly as possible to 20 μL of a solution containing the reassociation buffer and ~ 10 ng of HMG protein, and allowed to renature for 45 min. at 37°C. The conditions of reassociation were: 50 mM NaCl, 25 mM Tris-HCl pH 7.5, 1 mM DTT, 1 mM EDTA, 100 μg/mL bovine serum albumin. This reassociation process yields complexes between Form X and HMG1/2, which were purified by electrophoresis in 4% polyacrylamide gels (acrylamide:bis 30:1) in 6.7 mM Tris-acetate, 3.3 mM Na acetate, 1 mM EDTA, at 4°C with buffer recirculation. The complexes were electroeluted, proteins removed by chloroform treatment in 1% SDS and 1 M NaCl, and Form X ethanol precipitated and redissolved in 10 mM Tris-HCl, 1 mM EDTA, 0.1 M NaCl, pH 7.5. The presence of 0.1 M NaCl was found to stabilize Form X, presumably by stabilization of base pairing in the terminal double-stranded regions.</p>
      </sec>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgements</title>
        <p>We would like to thank Luigi Jonk, Nathalie Delgehyr, and Sandrine Jaouen for their help at various stages of this work. We are grateful to Susan Elsevier for critical reading of the manuscript. C.G. would also like to thank Prof. Alexander Rich (M.I.T.), in whose laboratory bands X were first observed. This work was made possible in part by grants from the Association Française contre les Myopathies, the Ligue Nationale Française Contre le Cancer, and the Association pour la Recherche contre le Cancer.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="B1">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hamada</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Kakunaga</surname>
              <given-names>T</given-names>
            </name>
          </person-group>
          <article-title> Potential Z-DNA forming sequences are highly dispersed in the human genome.</article-title>
          <source>Nature</source>
          <year>1982</year>
          <volume>298</volume>
          <fpage>396</fpage>
          <lpage>398</lpage>
          <pub-id pub-id-type="pmid">6283389</pub-id>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Timsit</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Moras</surname>
              <given-names>D</given-names>
            </name>
          </person-group>
          <article-title> Cruciform structures and functions.</article-title>
          <source>Q Rev Biophys</source>
          <year>1996</year>
          <volume>29</volume>
          <fpage>279</fpage>
          <lpage>307</lpage>
          <pub-id pub-id-type="pmid">9080546</pub-id>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Haniford</surname>
              <given-names>DB</given-names>
            </name>
            <name>
              <surname>Pulleyblank</surname>
              <given-names>DE</given-names>
            </name>
          </person-group>
          <article-title> Facile transition of poly[d(TG) · d(CA)] into a left-handed helix in physiological conditions.</article-title>
          <source>Nature</source>
          <year>1983</year>
          <volume>302</volume>
          <fpage>632</fpage>
          <lpage>634</lpage>
          <pub-id pub-id-type="pmid">6835398</pub-id>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nordheim</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Rich</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title> The sequence (dC-dA)n X (dG-dT)n forms left-handed Z-DNA in negatively supercoiled plasmids.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1983</year>
          <volume>80</volume>
          <fpage>1821</fpage>
          <lpage>1825</lpage>
          <pub-id pub-id-type="pmid">6572943</pub-id>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gaillard</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Strauss</surname>
              <given-names>F</given-names>
            </name>
          </person-group>
          <article-title> Association of poly(CA).poly(TG) DNA fragments into four-stranded complexes bound by HMG1 and 2.</article-title>
          <source>Science</source>
          <year>1994</year>
          <volume>264</volume>
          <fpage>433</fpage>
          <lpage>436</lpage>
          <pub-id pub-id-type="pmid">8153633</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Belotserkovskii</surname>
              <given-names>BP</given-names>
            </name>
            <name>
              <surname>Johnston</surname>
              <given-names>BH</given-names>
            </name>
          </person-group>
          <article-title> Denaturation and association of DNA sequences by certain polypropylene surfaces.</article-title>
          <source>Anal Biochem</source>
          <year>1997</year>
          <volume>251</volume>
          <fpage>251</fpage>
          <lpage>262</lpage>
          <pub-id pub-id-type="pmid">9299024</pub-id>
          <pub-id pub-id-type="doi">10.1006/abio.1997.2249</pub-id>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gaillard</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Flavin</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Woisard</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Strauss</surname>
              <given-names>F</given-names>
            </name>
          </person-group>
          <article-title> Association of double-stranded DNA fragments into multistranded DNA structures.</article-title>
          <source>Biopolymers</source>
          <year>1999</year>
          <volume>50</volume>
          <fpage>679</fpage>
          <lpage>689</lpage>
          <pub-id pub-id-type="pmid">10547523</pub-id>
          <pub-id pub-id-type="doi">10.1002/(SICI)1097-0282(199912)50:7&lt;679::AID-BIP1&gt;3.0.CO;2-3</pub-id>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Belotserkovskii</surname>
              <given-names>BP</given-names>
            </name>
            <name>
              <surname>Johnston</surname>
              <given-names>BH</given-names>
            </name>
          </person-group>
          <article-title> Polypropylene tube surfaces may induce denaturation and multimerization of DNA.</article-title>
          <source>Science</source>
          <year>1996</year>
          <volume>271</volume>
          <fpage>222</fpage>
          <lpage>223</lpage>
          <pub-id pub-id-type="pmid">8539626</pub-id>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gaillard</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Strauss</surname>
              <given-names>F</given-names>
            </name>
          </person-group>
          <article-title> Polypropylene tube surfaces may induce denaturation and multimerization of DNA - Response.</article-title>
          <source>Science</source>
          <year>1996</year>
          <volume>271</volume>
          <fpage>223</fpage>
          <pub-id pub-id-type="pmid">8539627</pub-id>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shure</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Vinograd</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title>The number of superhelical turns in native virion SV40 DNA and minicol DNA determined by the band counting method. </article-title>
          <source>Cell</source>
          <year>1976</year>
          <volume>8</volume>
          <fpage>215</fpage>
          <lpage>226</lpage>
          <pub-id pub-id-type="pmid">183892</pub-id>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shure</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Pulleyblank</surname>
              <given-names>DE</given-names>
            </name>
            <name>
              <surname>Vinograd</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title> The problems of eukaryotic and prokaryotic DNA packaging and in vivo conformation posed by superhelix density heterogeneity.</article-title>
          <source>Nucleic Acids Res</source>
          <year>1977</year>
          <volume>4</volume>
          <fpage>1183</fpage>
          <lpage>1205</lpage>
          <pub-id pub-id-type="pmid">197488</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Paull</surname>
              <given-names>TT</given-names>
            </name>
            <name>
              <surname>Haykinson</surname>
              <given-names>MJ</given-names>
            </name>
            <name>
              <surname>Johnson</surname>
              <given-names>RC</given-names>
            </name>
          </person-group>
          <article-title> The nonspecific DNA-binding and -bending proteins HMG1 and HMG2 promote the assembly of complex nucleoprotein structures.</article-title>
          <source>Genes Dev</source>
          <year>1993</year>
          <volume>7</volume>
          <fpage>1521</fpage>
          <lpage>1534</lpage>
          <pub-id pub-id-type="pmid">8339930</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Pil</surname>
              <given-names>PM</given-names>
            </name>
            <name>
              <surname>Chow</surname>
              <given-names>CS</given-names>
            </name>
            <name>
              <surname>Lippard</surname>
              <given-names>SJ</given-names>
            </name>
          </person-group>
          <article-title> High-mobility-group 1 protein mediates DNA bending as determined by ring closures.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1993</year>
          <volume>90</volume>
          <fpage>9465</fpage>
          <lpage>9469</lpage>
          <pub-id pub-id-type="pmid">8415724</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kmiec</surname>
              <given-names>EB</given-names>
            </name>
            <name>
              <surname>Holloman</surname>
              <given-names>WK</given-names>
            </name>
          </person-group>
          <article-title> Homologous pairing of DNA molecules by Ustilago rec1 protein is promoted by sequences of Z-DNA.</article-title>
          <source>Cell</source>
          <year>1986</year>
          <volume>44</volume>
          <fpage>545</fpage>
          <lpage>554</lpage>
          <pub-id pub-id-type="pmid">3948243</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sogo</surname>
              <given-names>JM</given-names>
            </name>
            <name>
              <surname>Stahl</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Koller</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Knippers</surname>
              <given-names>R</given-names>
            </name>
          </person-group>
          <article-title> Structure of replicating simian virus 40 minichromosomes. The replication fork, core histone segregation and terminal structures.</article-title>
          <source>J Mol Biol</source>
          <year>1986</year>
          <volume>189</volume>
          <fpage>189</fpage>
          <lpage>204</lpage>
          <pub-id pub-id-type="pmid">3023620</pub-id>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schwacha</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Kleckner</surname>
              <given-names>N</given-names>
            </name>
          </person-group>
          <article-title> Identification of joint molecules that form frequently between homologs but rarely between sister chromatids during yeast meiosis.</article-title>
          <source>Cell</source>
          <year>1994</year>
          <volume>76</volume>
          <fpage>51</fpage>
          <lpage>63</lpage>
          <pub-id pub-id-type="pmid">8287479</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schwacha</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Kleckner</surname>
              <given-names>N</given-names>
            </name>
          </person-group>
          <article-title> Identification of double Holliday junctions as intermediates in meiotic recombination.</article-title>
          <source>Cell</source>
          <year>1995</year>
          <volume>83</volume>
          <fpage>783</fpage>
          <lpage>791</lpage>
          <pub-id pub-id-type="pmid">8521495</pub-id>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Laurie</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Katritch</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Sogo</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Koller</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Dubochet</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Stasiak</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title> Geometry and physics of catenanes applied to the study of DNA replication.</article-title>
          <source>Biophys J</source>
          <year>1998</year>
          <volume>74</volume>
          <fpage>2815</fpage>
          <lpage>2822</lpage>
          <pub-id pub-id-type="pmid">9635735</pub-id>
        </citation>
      </ref>
      <ref id="B19">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lucas</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Hyrien</surname>
              <given-names>O</given-names>
            </name>
          </person-group>
          <article-title>Hemicatenanes form upon inhibition of DNA replication.</article-title>
          <source>Nucleic Acids Res</source>
          <year>2000</year>
          <volume>28</volume>
          <fpage>2187</fpage>
          <lpage>2193</lpage>
          <pub-id pub-id-type="pmid">10773090</pub-id>
          <pub-id pub-id-type="doi">10.1093/nar/28.10.2187</pub-id>
        </citation>
      </ref>
      <ref id="B20">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rippe</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>von Hippel</surname>
              <given-names>PH</given-names>
            </name>
            <name>
              <surname>Langowski</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title> Action at a distance: DNA-looping and initiation of transcription.</article-title>
          <source>Trends Biochem Sci</source>
          <year>1995</year>
          <volume>20</volume>
          <fpage>500</fpage>
          <lpage>506</lpage>
          <pub-id pub-id-type="pmid">8571451</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0968-0004(00)89117-3</pub-id>
        </citation>
      </ref>
      <ref id="B21">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Engel</surname>
              <given-names>JD</given-names>
            </name>
            <name>
              <surname>Tanimoto</surname>
              <given-names>K</given-names>
            </name>
          </person-group>
          <article-title> Looping, linking, and chromatin activity: new insights into beta-globin locus regulation.</article-title>
          <source>Cell</source>
          <year>2000</year>
          <volume>100</volume>
          <fpage>499</fpage>
          <lpage>502</lpage>
          <pub-id pub-id-type="pmid">10721987</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record><record><header><identifier>oai:pubmedcentral.nih.gov:29058</identifier><datestamp>2001-03-22</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">29058</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-1-2</article-id>
      <article-id pub-id-type="pmid">11001589</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-1-2</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Identification of sites phosphorylated by the vaccinia virus B1R kinase in viral protein H5R</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" contrib-type="author">
          <name>
            <surname>Brown</surname>
            <given-names>Neil G</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>n.g.brown@bio.gla.ac.uk</email>
        </contrib>
        <contrib id="A2" contrib-type="author">
          <name>
            <surname>Nick Morrice</surname>
            <given-names>D</given-names>
          </name>
          <xref ref-type="aff" rid="I2">2</xref>
          <email>dnmorrice@dux.dundee.ac.uk</email>
        </contrib>
        <contrib id="A3" contrib-type="author">
          <name>
            <surname>Beaud</surname>
            <given-names>Georges</given-names>
          </name>
          <xref ref-type="aff" rid="I3">3</xref>
          <email>beaud@ijm.jussieu.fr</email>
        </contrib>
        <contrib id="A4" contrib-type="author">
          <name>
            <surname>Hardie</surname>
            <given-names>Grahame</given-names>
          </name>
          <xref ref-type="aff" rid="I4">4</xref>
          <email>dghardie@dux.dundee.ac.uk</email>
        </contrib>
        <contrib id="A5" corresp="yes" contrib-type="author">
          <name>
            <surname>Leader</surname>
            <given-names>David P</given-names>
          </name>
          <xref ref-type="aff" rid="I5">5</xref>
          <email>d.leader@bio.gla.ac.uk</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Division of Biochemistry and Molecular Biology, IBLS, University of Glasgow, Glasgow G12 8QQ Scotland, UK</aff>
      <aff id="I2"><label>2</label>Department of Biochemistry, University of Dundee, MSI/WTB Complex, Dow St., Dundee DD1 5EH, Scotland, UK</aff>
      <aff id="I3"><label>3</label>Institut Jacques Monod du CNRS et de l'Université de Paris 7, 75005 Paris, France</aff>
      <aff id="I4"><label>4</label>Department of Biochemistry, University of Dundee, MSI/WTB Complex, Dow St., Dundee DD1 5EH, Scotland, UK</aff>
      <aff id="I5"><label>5</label>Division of Biochemistry and Molecular Biology, IBLS, University of Glasgow, Glasgow G12 8QQ Scotland, UK</aff>
      <pub-date pub-type="collection">
        <year>2000</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>5</day>
        <month>9</month>
        <year>2000</year>
      </pub-date>
      <volume>1</volume>
      <fpage>2</fpage>
      <lpage>2</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/1/2"/>
      <history>
        <date date-type="received">
          <day>14</day>
          <month>8</month>
          <year>2000</year>
        </date>
        <date date-type="accepted">
          <day>25</day>
          <month>8</month>
          <year>2000</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2000 Brown et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2000</copyright-year>
        <copyright-holder>Brown et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>Vaccinia virus gene B1R encodes a serine/threonine protein kinase. <italic>In vitro</italic> this protein kinase phosphorylates ribosomal proteins Sa and S2 and vaccinia virus protein H5R, proteins that become phosphorylated during infection. Nothing is known about the sites phosphorylated on these proteins or the general substrate specificity of the kinase. The work described is the first to address these questions.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>Vaccinia virus protein H5R was phosphorylated by the B1R protein kinase <italic>in vitro</italic>, digested with V8 protease, and phosphopeptides separated by HPLC. The <italic>N</italic>-terminal sequence of one radioactively labelled phosphopeptide was determined and found to correspond to residues 81-87 of the protein, with Thr-84 and Thr-85 being phosphorylated. A synthetic peptide based on this region of the protein was shown to be a substrate for the B1R protein kinase, and the extent of phosphorylation was substantially decreased if either Thr residue was replaced by an Ala.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>We have identified the first phosphorylation site for the vaccinia virus B1R protein kinase. This gives important information about the substrate-specificity of the enzyme, which differs from that of other known protein kinases. It remains to be seen whether the same site is phosphorylated <italic>in vivo</italic>.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>Vaccinia virus is a large DNA virus that replicates in the host cell cytoplasm in granular sites called virosomes [<xref ref-type="bibr" rid="B1">1</xref>]. It encodes at least two protein kinases belonging to the cellular family of serine/threonine protein kinases, the products of the B1R [<xref ref-type="bibr" rid="B2">2</xref>,<xref ref-type="bibr" rid="B3">3</xref>] and F10L genes [<xref ref-type="bibr" rid="B4">4</xref>]. The F10L kinase is encapsidated in the virion and plays an essential role in virion morphogenesis [<xref ref-type="bibr" rid="B5">5</xref>,<xref ref-type="bibr" rid="B6">6</xref>]. The B1R protein kinase is expressed early in infection, is found in the virosomes, and is also packaged into virions [<xref ref-type="bibr" rid="B7">7</xref>]. It appears to be an essential viral protein, and temperature-sensitive mutations that map to the B1R gene produce virus that cannot replicate its DNA at the restrictive temperature [<xref ref-type="bibr" rid="B2">2</xref>,<xref ref-type="bibr" rid="B8">8</xref>]. The B1R kinase does not appear to have a broad substrate specificity, and, although it has some activity against the acidic protein, casein, this is a poor substrate compared with the enzyme's known physiological substrates. Three proteins which become phosphorylated during infection of cells with vaccinia virus have been shown to be substrates of the B1R protein kinase <italic>in vitro</italic>. Two of these are the ribosomal proteins Sa and S2 [<xref ref-type="bibr" rid="B9">9</xref>,<xref ref-type="bibr" rid="B10">10</xref>] and the third is the product of the H5R open reading frame of the vaccinia virus genome [<xref ref-type="bibr" rid="B10">10</xref>,<xref ref-type="bibr" rid="B11">11</xref>]. </p>
      <p>The fact that the B1R kinase phosphorylates these proteins <italic>in vitro</italic> does not, of course, prove that it is responsible for their phosphorylation during infection by virus <italic>in vivo.</italic> However, one piece of evidence consistent with this possibility is that all these proteins have multiple phosphorylation sites predominantly involving threonine (rather than the more usual serine) residues, and it is threonine residues on the proteins that the B1R kinase phosphorylates <italic>in vitro</italic>. In the case of protein H5R - the subject of the current work - there is further reason to believe that the B1R kinase contributes to the phosphorylation <italic>in vivo</italic>. In a mutant strain of virus, temperature-sensitive for B1R, the proportion of underphosophorylated H5R decreases at the restrictive temperature (G. Beaud and R. Beaud, unpublished).</p>
      <p>In cells infected with a temperature-sensitive mutant of the B1R gene, the proportion of underphosphorylated H5R protein decreases at the restrictive temperature, showing that the B1R protein kinase controls the phosphorylation state of the H5R protein synthesized at the early stage of vaccinia virus infection [<xref ref-type="bibr" rid="B12">12</xref>]. It has recently been shown that most of the H5R protein is found in virosomes, although some of the more highly phosphorylated forms of the protein appear to be cytoplasmic, suggesting multiple roles in vaccinia virus development [<xref ref-type="bibr" rid="B13">13</xref>]. Kovacs and Moss [<xref ref-type="bibr" rid="B14">14</xref>] have demonstrated that the H5R protein is, in fact, equivalent to the late stage-specific transcription factor VLTF-4, and Black <italic>et al.</italic> [<xref ref-type="bibr" rid="B15">15</xref>] have showed that it associates with protein G2R, a putative late transcription elongation factor. In contrast, studies of a dominant temperature-sensitive mutant of H5R by DeMasi and Traktman [<xref ref-type="bibr" rid="B16">16</xref>] suggest a role in virion morphogenesis. A knowledge of the phosphorylation sites on the H5R protein is needed to test whether phosphorylation has a role in either of these processes, and we have made the first steps in this direction by identifying two threonine residues in the protein that are substrates for the B1R protein kinase.</p>
    </sec>
    <sec>
      <title>Results</title>
      <p>Vaccinia virus protein H5R isolated from infected HeLa cells was labelled <italic>in vitro</italic> with [γ-<sup>32</sup>P]ATP by recombinant B1R protein kinase, all as described in <italic>Experimental</italic>. The products of the reaction were digested with V8 protease and then passed through a SEP-PAK cartridge to remove the majority of the unreacted [γ-<sup>32</sup>P]ATP. The radioactive V8 peptides recovered from the cartridge were then applied to a reverse-phase HPLC column and eluted with a gradient of acetonitrile. This removed the residual [γ-<sup>32</sup>P]ATP, and the majority of the radioactivity associated with peptides eluted as a doublet at 20-30% acetonitrile (designated 3 in Fig. <xref ref-type="fig" rid="F1">1a</xref>), which was collected, concentrated by centrifugal evaporation, redissolved and applied to a microbore HPLC column to resolve the peptides further. A first run using a 15-25% gradient of acetonitrile in 0.1% trifluoroacetic acid revealed that this preparation of the radioactive doublet contained perhaps a dozen peptides (Fig. <xref ref-type="fig" rid="F1">1b</xref>). As these were incompletely resolved, two regions of the gradient containing the most radioactive peaks (designated in the figure as I and II, containing gradient fractions 30-33 and 35-36, respectively) were collected and reapplied in turn to the microbore column, but this time the gradient for elution comprised 0-50% acetonitrile in 20 mM NaCl without trifluoroacetic acid. Insufficient radioactivity was recovered from the peaks resolved in fraction I for sequence analysis. Fraction II yielded more radioactive peptides, separated from adjacent peptides and partly resolved from each other (peaks 28 and 29 in Fig <xref ref-type="fig" rid="F1">1c</xref>). </p>
      <p>The two peaks, 28 and 29, from the microbore HPLC separation of fraction II (Fig. <xref ref-type="fig" rid="F1">1c</xref>) were separately subjected to sequence analysis using an Applied Biosystems gas phase sequencer, and the radioactivity of the PTH derivative at each cycle of Edman degradation was determined by scintillation spectrometry. The results of thirteen cycles of automatic Edman degradation on peak 29 are shown in Fig <xref ref-type="fig" rid="F2">2</xref>. The first seven residues of the peptide were identified as YHQTTEK, which correspond exactly to residues 81-87 of H5R and do not occur elsewhere in the protein [<xref ref-type="bibr" rid="B17">17</xref>]. (The preceding residue 80 in the protein is glutamic acid, consistent with the substrate specificity of V8 protease.) The <sup>32</sup>P was released from the peptide predominantly at cycles 4, 5 and 6. As there is always carry-over from one cycle to the next, we can conclude that both residues Thr-84 and Thr-85 of H5R are phosphorylated by the vaccinia virus B1R protein kinase. Analysis of fraction 28 gave similar results to those for fraction 29 (not shown).</p>
      <p>In many cases it has been found that peptides containing the phosphorylation sites of proteins are also substrates for the protein kinase catalysing the phosphorylation of the protein. We therefore synthesized the peptide RRIEEYHQTTEKN, which represents amino acid residues 78-88 of H5R preceded by two arginine residues (not present at positions 76-77 of the protein) to make the peptide easier to handle. As preliminary studies indicated that this served as a substrate for the B1R kinase we had two additional peptides constructed in one of which Ala replaced Thr-84 and in the other of which it replaced Thr-85. After incubation with B1R kinase and [γ-<sup>32</sup>P]ATP the peptides were subjected to high-voltage thin layer electrophoresis to resolve the peptides from the unreacted [γ-<sup>32</sup>P]ATP. Fig <xref ref-type="fig" rid="F3">3</xref> shows that although there was some labelling of the two Ala-replacement peptides, this was much less than with the parent peptide. (Measurement indicated that this was about 10% of incorporation into the parent peptide). It would therefore appear that the recognition specificity for phosphorylation at either Thr residue includes the other Thr, despite the fact that in one case it is on the <italic>N</italic>-terminal side of the phosphorylated residue, and in the other case on the <italic>C</italic>-terminal side.</p>
      <fig position="float" id="F1">
        <label>Figure 1</label>
        <caption>
          <p>HPLC fractionation of V8 peptides from vaccinia virus protein H5R. (a) HPLC fractionation of hydrolysate after passage through a SEP-PAK column using a gradient of 0-50% acetonitrile. The fractions encompassed by the horizontal bar (region 3) were collected for further analysis. (b) Microbore HPLC fractionation of region 3 from (a). A gradient of 15-25% acetonitrile in 0.1% trifluoroacetic acid was used and the fractions encompassed by the horizontal bars (regions I and II) collected for further analysis). (c) Microbore HPLC fractionation of region II from (b). A gradient of 0-50% acetonitrile in 20 mM NaCl (in the absence of trifluoroacetic acid - i.e. at neutral pH) was used and the fractions 28 and 29 collected for sequence analysis). The direction of increasing gradient is from left to right in all three frames; the ultraviolet absorbance trace is labelled as A<sub>280</sub>, and the radioactivity trace as <sup>32</sup>P.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-2-1"/>
      </fig>
      <fig position="float" id="F2">
        <label>Figure 2</label>
        <caption>
          <p>Sequence analysis of H5R phosphopeptide. Fraction 29 from Fig <xref ref-type="fig" rid="F1">1c</xref> was subjected to automatic Edman degradation, and the <sup>32</sup>P radioactivity released at each stage measured. The identity of the phenylthiohydantoin derivative from the first seven cycles was unequivocal and is indicated.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-2-2"/>
      </fig>
      <fig position="float" id="F3">
        <label>Figure 3</label>
        <caption>
          <p>Phosphorylation of synthetic peptides. Peptides were phosphorylated as described in the Experimental section and subjected to electrophoresis on thin-layer cellulose at pH 3.5. The position of the phosphopeptides is indicated by the arrow, the identification being based on the fact that the ninhydrin-stained material (predominantly unphosphorylated and hence with a greater positive charge) migrated just ahead of this. Lane 1 contained RRIEEYHQTTEKN, lane 2: RRIEEYHQ<bold>A</bold>TEKN, lane 3: RRIEEYHQT<bold>A</bold>EKN, and lane 4; no peptide.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-2-3"/>
      </fig>
    </sec>
    <sec>
      <title>Discussion</title>
      <p>We have identified two phosphorylation sites for vaccinia virus protein kinase B1R in viral protein H5R, the first phosphorylation sites to be determined for this protein kinase. Although we have not established whether these same sites are also phosphorylated during viral infection, our work provides important biochemical information on the substrate specificity of the protein kinase. The sequence containing the two phosphorylated threonine residues - EEYHQTTEKNSP - is neither particularly basic or acidic, consistent with the failure of basic or acidic model peptides to serve as substrates for the B1R protein kinase. It is interesting that this does not resemble sequences reported to be phosphorylated by other protein kinases, including those phosphorylated by CK1, the known cellular protein kinase most closely related to the B1R kinase. This latter generally requires a phosphoserine three amino acids to the <italic>N</italic>-terminal side of the phosphate-acceptor site, although in some artificial substrates a highly acidic <italic>N</italic>-terminal region can substitute for this [<xref ref-type="bibr" rid="B18">18</xref>]. One interesting biochemical question is what residues in the target sequence we have identified are the determinants for the substrate-specificity for the B1R protein kinase. In one approach to this we have examined the sequences of other known substrates for the B1R kinase (ribosomal proteins Sa and S2) but have been unable to identify potential similarities to the H5R phosphopeptide. In this regard it should be mentioned that although the synthetic peptide RRIEEYHQTTEKN did serve as a substrate for the enzyme (Fig. <xref ref-type="fig" rid="F3">3</xref>), we found its phosphorylation to be weak compared with that produced by other protein kinases on their model peptides (Approximately 0.1 mol phosphate per mol of peptide, compared with 1.8-2.0 mol phosphate per mol H5R protein). Although the additional arginine residues in the peptide complicate the interpretation, it may well be that there are three-dimensional determinants - absent from the synthetic peptide - that contribute to the substrate specificity of the enzyme. There are precedents for this in some other protein kinases [<xref ref-type="bibr" rid="B18">18</xref>].</p>
      <p>The vaccinia protein H5R has been shown by isoelectric focusing to exist in at least four differently charged forms [<xref ref-type="bibr" rid="B11">11</xref>,<xref ref-type="bibr" rid="B13">13</xref>], suggesting that there are at least least five different phosphorylation sites on the protein. Consistent with this are the results of experiments (not shown) in which we employed recombinant H5R in which Thr-84 and Thr-85 had been replaced by Ala residues, and found that this still served as a substrate for the B1R protein kinase. It is possible that one or more of these additional sites is present in the HPLC fraction I of Fig <xref ref-type="fig" rid="F1">1b</xref>, the peptides resolved from which were insufficiently radioactive for sequence analysis. </p>
      <p>Although this work represents the first identification of phosphorylation sites for the vaccinia B1R kinase, it remains to be established whether these same sites are phosphorylated <italic>in vivo</italic>, and, if so, with what physiological significance. However it should now be possible to address this question by constructing recombinant virus with amino acid substitutions at the positions of phosphorylation. </p>
    </sec>
    <sec>
      <title>Conclusions</title>
      <p>Vaccinia virus protein kinase B1R phosphorylates the virus protein H5R <italic>in vitro</italic> at the threonine residues Thr-84 and Thr-85 within the region:</p>
      <p>EEYHQ<bold>TT</bold>EKNSP</p>
      <p>A synthetic peptide based on this sequence also acted as a substrate. We conclude that this sequence determines, at least in part, the substrate specificity of the vaccinia B1R protein kinase, although it is unclear which amino acid residues are the key determinants within this sequence. There are other phosphorylation sites for the kinase on protein H5R, but these remain to be determined.</p>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and Methods</title>
      <sec>
        <title>Preparation and labelling of H5R protein</title>
        <p>The preparation of authentic vaccinia H5R protein and recombinant B1R protein kinase were as previously described [<xref ref-type="bibr" rid="B11">11</xref>]. In some experiments a trpE-H5R fusion protein (pATH11-Ag35) was used [<xref ref-type="bibr" rid="B19">19</xref>]. For phosphorylation, three identical reactions contained H5R protein (70 pmol), B1R protein kinase (90 μl), Tris-HCl, pH 7.4 (20 mM), magnesium chloride (5 mM), ATP (50 μM), [γ-<sup>32</sup>P]ATP (50 μCi) and dithiothreitol (2 mM) in a total volume of 500 μl. Incubation was for 30 min at 30° C.</p>
      </sec>
      <sec>
        <title>Proteolytic digestion of H5R protein</title>
        <p>The 500 μl reaction mixtures, above, were adjusted to 50 mM Tris-HCl, pH 7.4, and 0.01% reduced Triton X-100 at a final volume of 600 μl. To this was added 0.4 μg V8 protease (Boehringer Mannheim) and incubation carried out at 30° C for 18 h. To prepare the peptides for HPLC analysis the reaction mixtures were pooled and applied to a SEP-PAK cartridge (prewashed with successive 10 ml portions of 50% acetonitrile and water) and eluted with water (40 ml) followed by 50% acetonitrile (40 ml) and finally 100% acetonitrile (30 ml). A large peak of radioactivity (unreacted ATP) eluted with the water and was discarded, and a smaller broad peak of radioactivity that eluted with 50% acetonitrile was retained and concentrated to 200 μl by rotary evaporation.</p>
      </sec>
      <sec>
        <title>Purification of H5R peptides and sequence analysis</title>
        <p>Initial purification was with a Vydac protein and Peptide C18 column (25 × 04 cm) on a Gilson HPLC system, and this was followed by further purification on a Vydac C18 2.1 × 180 mm microbore column. Details of the gradients used are given in the text. Peptides were sequenced on an Applied Biosystems 476A protein sequencer and phosphorylation sites were analysed using solid phase Edmann sequencing [<xref ref-type="bibr" rid="B20">20</xref>].</p>
      </sec>
      <sec>
        <title>Labelling and analysis of synthetic peptides</title>
        <p>Synthetic peptides were purchased from Thistle Research, Glasgow, UK. Each peptide (3 mM) was incubated with [γ-<sup>32</sup>P]ATP (6.3 μCi) B1R protein kinase (4 μl), Tris-HCl, pH 7.4 (20 mM), magnesium chloride (5 mM), ATP (50 μM), and dithiothreitol (2 mM) in a total volume of 20 μl. Incubation was for 30 min at 30° C. The reaction mixtures were applied in 1 cm strips to thin layer cellulose plates and subjected to electrophoresis for 4 h at 200 V in a solution of pyridine : acetic acid : water (20:200:1780) at pH 3.5. The plates were dried, stained with ninhydrin to locate the unphosphorylated peptides, and subjected to autoradiography.</p>
      </sec>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgements</title>
        <p>We thank the Wellcome Trust for support.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="B1">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Moss</surname>
              <given-names>B</given-names>
            </name>
          </person-group>
          <article-title>Poxviridae: the viruses and their replication.</article-title>
          <source>In Fields Virology, 3rd edn (Edited by Field BN, Knipe DM, Howley, PM) Philadelphia: Lippincott-Raven,</source>
          <year>1996</year>
          <fpage>2637</fpage>
          <lpage>2671</lpage>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rempel</surname>
              <given-names>RE</given-names>
            </name>
            <name>
              <surname>Traktman</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <article-title>Vaccinia virus B1 kinase: phenotypic analysis of temperature-sensitive mutants and enzymatic characterization of recombinant proteins.</article-title>
          <source>J Virol</source>
          <year>1992</year>
          <volume>66</volume>
          <fpage>4413</fpage>
          <lpage>4426</lpage>
          <pub-id pub-id-type="pmid">1602551</pub-id>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lin</surname>
              <given-names>SQ</given-names>
            </name>
            <name>
              <surname>Wen</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Broyles</surname>
              <given-names>SS</given-names>
            </name>
          </person-group>
          <article-title>The vaccinia virus B1R gene product is a serine/threonine protein kinase.</article-title>
          <source>J Virol</source>
          <year>1992</year>
          <volume>66</volume>
          <fpage>2717</fpage>
          <lpage>2723</lpage>
          <pub-id pub-id-type="pmid">1560522</pub-id>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lin</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Broyles</surname>
              <given-names>SS</given-names>
            </name>
          </person-group>
          <article-title>Vaccinia protein kinase 2: a second essential serine/threonine protein kinase encoded by vaccinia virus.</article-title>
          <source>Proc Natl Acad Sci U S A</source>
          <year>1994</year>
          <volume>91</volume>
          <fpage>7653</fpage>
          <lpage>7657</lpage>
          <pub-id pub-id-type="pmid">8052637</pub-id>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Traktman</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Caligiuri</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Jesty</surname>
              <given-names>SA</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Sankar</surname>
              <given-names>U</given-names>
            </name>
          </person-group>
          <article-title>Temperature-sensitive mutants with lesions in the vaccinia virus F10 kinase undergo arrest at the earliest stage of virion morphogenesis.</article-title>
          <source>J Virol</source>
          <year>1995</year>
          <volume>69</volume>
          <fpage>6581</fpage>
          <lpage>6587</lpage>
          <pub-id pub-id-type="pmid">7666563</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wang</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Shuman</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Vaccinia virus morphogenesis is blocked by temperature-sensitive mutations in the F10 gene, which encodes protein kinase 2.</article-title>
          <source> J Virol</source>
          <year>1995</year>
          <volume>69</volume>
          <fpage>6376</fpage>
          <lpage>88</lpage>
          <pub-id pub-id-type="pmid">7666539</pub-id>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Banham</surname>
              <given-names>AH</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>GL</given-names>
            </name>
          </person-group>
          <article-title>Vaccinia virus gene B1R encodes a 34-kDa serine/threonine protein kinase that localizes in cytoplasmic factories and is packaged into virions.</article-title>
          <source>Virology</source>
          <year>1992</year>
          <volume>191</volume>
          <fpage>803</fpage>
          <lpage>812</lpage>
          <pub-id pub-id-type="pmid">1448924</pub-id>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rempel</surname>
              <given-names>RE</given-names>
            </name>
            <name>
              <surname>Anderson</surname>
              <given-names>MK</given-names>
            </name>
            <name>
              <surname>Evans</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Traktman</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <article-title>Temperature-sensitive vaccinia virus mutants identify a gene with an essential role in viral replication.</article-title>
          <source>J Virol</source>
          <year>1990</year>
          <volume>64</volume>
          <fpage>574</fpage>
          <lpage>583</lpage>
          <pub-id pub-id-type="pmid">2296077</pub-id>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Banham</surname>
              <given-names>AH</given-names>
            </name>
            <name>
              <surname>Leader</surname>
              <given-names>DP</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>GL</given-names>
            </name>
          </person-group>
          <article-title>Phosphorylation of ribosomal proteins by the vaccinia virus B1R protein kinase.</article-title>
          <source>FEBS Lett</source>
          <year>1993</year>
          <volume>321</volume>
          <fpage>27</fpage>
          <lpage>31</lpage>
          <pub-id pub-id-type="pmid">8467908</pub-id>
          <pub-id pub-id-type="doi">10.1016/0014-5793(93)80614-Z</pub-id>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Beaud</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Sharif</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Topa-Masse</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Leader</surname>
              <given-names>DP</given-names>
            </name>
          </person-group>
          <article-title>Ribosomal protein S2/Sa kinase purified from HeLa cells infected with vaccinia virus corresponds to the B1R protein kinase and phosphorylates in vitro the viral ssDNA-binding protein.</article-title>
          <source>J Gen Virol</source>
          <year>1994</year>
          <volume>75</volume>
          <fpage>283</fpage>
          <lpage>293</lpage>
          <pub-id pub-id-type="pmid">8113749</pub-id>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Beaud</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Beaud</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Leader</surname>
              <given-names>DP</given-names>
            </name>
          </person-group>
          <article-title>Vaccinia virus gene H5R encodes a protein that is phosphorylated by the multisubstrate vaccinia virus B1R protein kinase.</article-title>
          <source>J Virol</source>
          <year>1995</year>
          <volume>69</volume>
          <fpage>1819</fpage>
          <lpage>1826</lpage>
          <pub-id pub-id-type="pmid">7853522</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Beaud</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Beaud</surname>
              <given-names>R</given-names>
            </name>
          </person-group>
          <article-title>Temperature-dependent phosphorylation state of the H5R protein synthesised at the early stage of infection in cells infected with vaccinia virus ts mutants of the B1R and F10L protein kinases.</article-title>
          <source>Intervirology</source>
          <year>2000</year>
          <volume>43</volume>
          <fpage>67</fpage>
          <lpage>70</lpage>
          <pub-id pub-id-type="pmid">10773740</pub-id>
          <pub-id pub-id-type="doi">10.1159/000025025</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Beaud</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Beaud</surname>
              <given-names>R</given-names>
            </name>
          </person-group>
          <article-title>Preferential virosomal location of underphosphorylated H5R protein synthesized in vaccinia virus-infected cells.</article-title>
          <source>J Gen Virol</source>
          <year>1997</year>
          <volume>78</volume>
          <fpage>3297</fpage>
          <lpage>3302</lpage>
          <pub-id pub-id-type="pmid">9400980</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kovacs</surname>
              <given-names>GR</given-names>
            </name>
            <name>
              <surname>Moss</surname>
              <given-names>B</given-names>
            </name>
          </person-group>
          <article-title>The vaccinia virus H5R gene encodes late gene transcription factor 4: purification, cloning, and overexpression.</article-title>
          <source>J Virol</source>
          <year>1996</year>
          <volume>70</volume>
          <fpage>6796</fpage>
          <lpage>6802</lpage>
          <pub-id pub-id-type="pmid">8794318</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Black</surname>
              <given-names>EP</given-names>
            </name>
            <name>
              <surname>Moussache</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Condit</surname>
              <given-names>RC</given-names>
            </name>
          </person-group>
          <article-title>Characterization of the interactions among vaccinia virus transcription factors G2R, A18R, and H5R. </article-title>
          <source>Virology</source>
          <year>1998</year>
          <volume>245</volume>
          <fpage>313</fpage>
          <lpage>322</lpage>
          <pub-id pub-id-type="pmid">9636370</pub-id>
          <pub-id pub-id-type="doi">10.1006/viro.1998.9166</pub-id>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>DeMasi</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Traktman</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <article-title>Clustered charge-to-alanine mutagenesis of the vaccina virus H5 gene: isolation of a dominant temperature-sensitive mutant with a profound defect in morphogenesis.</article-title>
          <source> J Virol</source>
          <year>2000</year>
          <volume>74</volume>
          <fpage>2393</fpage>
          <lpage>2405</lpage>
          <pub-id pub-id-type="pmid">10666270</pub-id>
          <pub-id pub-id-type="doi">10.1128/JVI.74.5.2393-2405.2000</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Goebel</surname>
              <given-names>SJ</given-names>
            </name>
            <name>
              <surname>Johnson</surname>
              <given-names>GP</given-names>
            </name>
            <name>
              <surname>Perkus</surname>
              <given-names>ME</given-names>
            </name>
            <name>
              <surname>Davis</surname>
              <given-names>SW</given-names>
            </name>
            <name>
              <surname>Winslow</surname>
              <given-names>JP</given-names>
            </name>
            <name>
              <surname>Paoletti</surname>
              <given-names>E</given-names>
            </name>
          </person-group>
          <article-title>The complete sequence of vaccinia virus.</article-title>
          <source>Virology</source>
          <year>1990</year>
          <volume>179</volume>
          <fpage>247</fpage>
          <lpage>266</lpage>
          <pub-id pub-id-type="pmid">2219722</pub-id>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Pinna</surname>
              <given-names>LA</given-names>
            </name>
            <name>
              <surname>Ruzzene</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <article-title>How do protein kinases recognize their substrates?</article-title>
          <source>Biochim Biophys Acta</source>
          <year>1996</year>
          <volume>1314</volume>
          <fpage>191</fpage>
          <lpage>225</lpage>
          <pub-id pub-id-type="pmid">8982275</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0167-4889(96)00083-3</pub-id>
        </citation>
      </ref>
      <ref id="B19">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mohandas</surname>
              <given-names>AR</given-names>
            </name>
            <name>
              <surname>Dekaban</surname>
              <given-names>GA</given-names>
            </name>
            <name>
              <surname>Dales</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Vaccinia virion surface polypeptide Ag35 expressed from a baculovirus vector is targeted to analogous poxvirus and insect virus components</article-title>
          <source>Virology</source>
          <year>1994</year>
          <volume>200</volume>
          <fpage>207</fpage>
          <lpage>219</lpage>
          <pub-id pub-id-type="pmid">8128622</pub-id>
          <pub-id pub-id-type="doi">10.1006/viro.1994.1179</pub-id>
        </citation>
      </ref>
      <ref id="B20">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ben-Levy</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Leishton</surname>
              <given-names>IA</given-names>
            </name>
            <name>
              <surname>Doza</surname>
              <given-names>YN</given-names>
            </name>
            <name>
              <surname>Attwood</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Morrice</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Marshall</surname>
              <given-names>CJ</given-names>
            </name>
            <name>
              <surname>Cohen</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <article-title>Identification of novel phosphorylation sites required for activation of MAPKAP kinase-2</article-title>
          <source>EMBO J</source>
          <year>1995</year>
          <volume>23</volume>
          <fpage>5920</fpage>
          <lpage>5930</lpage>
          <pub-id pub-id-type="pmid">8846784</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record><record><header><identifier>oai:pubmedcentral.nih.gov:29059</identifier><datestamp>2001-03-22</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">29059</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-1-3</article-id>
      <article-id pub-id-type="pmid">11231883</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-1-3</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Methodology Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>A direct method to visualise the aryl acylamidase activity on cholinesterases in polyacrylamide gels</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" corresp="yes" contrib-type="author">
          <name>
            <surname>Jaganathan</surname>
            <given-names>Lakshmanan</given-names>
          </name>
          <xref ref-type="aff" rid="I2">2</xref>
          <email>jagscbe@yahoo.com</email>
        </contrib>
        <contrib id="A2" contrib-type="author">
          <name>
            <surname>Boopathy</surname>
            <given-names>Rathanam</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>boopathy@md4.vsnl.net.in</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Department of Biotechnology, Bharathiar University, Coimbatore, India</aff>
      <aff id="I2"><label>2</label>Hyderabad Eye Research Foundation, LV Prasad Eye Institute, Hyderabad, India</aff>
      <pub-date pub-type="collection">
        <year>2000</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>20</day>
        <month>12</month>
        <year>2000</year>
      </pub-date>
      <volume>1</volume>
      <fpage>3</fpage>
      <lpage>3</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/1/3"/>
      <history>
        <date date-type="received">
          <day>27</day>
          <month>7</month>
          <year>2000</year>
        </date>
        <date date-type="accepted">
          <day>20</day>
          <month>12</month>
          <year>2000</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2000 Jaganathan and Boopathy; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2000</copyright-year>
        <copyright-holder>Jaganathan and Boopathy; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>In vertebrates, two types of cholinesterases exist, acetylcholinesterase and butyrylcholinesterase. The function of acetylcholinesterase is to hydrolyse acetylcholine, thereby terminating the neurotransmission at cholinergic synapse, while the precise physiological function of butyrylcholinesterase has not been identified. The presence of cholinesterases in tissues that are not cholinergically innervated indicate that cholinesterases may have functions unrelated to neurotransmission. Furthermore, cholinesterases display a genuine aryl acylamidase activity apart from their predominant acylcholine hydrolase activity. The physiological significance of this aryl acylamidase activity is also not known. The study on the aryl acylamidase has been, in part hampered by the lack of a specific method to visualise this activity. We have developed a method to visualise the aryl acylamidase activity on cholinesterase in polyacrylamide gels.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>The <italic>o</italic>-nitroaniline liberated from <italic>o</italic>-nitroacetanilide by the action of aryl acylamidase activity on cholinesterases, in the presence of nitrous acid formed a diazonium compound. This compound gave an azo dye complex with N-(1-napthyl)-ethylenediamine, which appeared as purple bands in polyacrylamide gels. Treating the stained gels with trichloroacetic acid followed by Tris-HCl buffer helped in fixation of the stain in the gels. By using specific inhibitors for acetylcholinesterase and butyrylcholinesterase, respectively, differential staining for the aryl acylamidase activities on butyrylcholinesterase and acetylcholinesterase in a sample containing both these enzymes has been demonstrated. A linear relationship between the intensity of colour developed and activity of the enzyme was obtained.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>A novel method to visualise the aryl acylamidase activity on cholinesterases in polyacrylamide gels has been developed.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>Cholinesterases (ChEs) are evolutionarily conserved type B carboxylesterase enzymes that share extensive sequence homology. In vertebrates two types of ChEs were identified based on their distinct substrate specificity and inhibitor sensitivity. The acetylcholinesterase (AChE; EC 3.1.1.7) specifically catalyses the hydrolysis of acetylcholine and is subjected to marked inhibition by its own natural substrate. In contrast, butyrylcholinesterase (BChE; EC 3.1.1.8) is capable of degrading a wider range of choline esters and is not inhibited by its substrate [<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>]. AChE is selectively inhibited by BW 284c51, while BChE is specifically inhibited by tetraisopropylpyrophosphoramide (iso-OMPA) [<xref ref-type="bibr" rid="B3">3</xref>]. AChE is widely distributed in the nervous system and its role in rapidly terminating nerve impulse by hydrolysing acetylcholine in cholinergic synapses is well documented [<xref ref-type="bibr" rid="B1">1</xref>]. BChE is produced in the liver and enriched in the circulation. In addition, it is also present in adipose tissue, intestine, smooth muscle cells, white matter of the brain and many other tissues [<xref ref-type="bibr" rid="B4">4</xref>]. The exact physiological function of BChE is still elusive. It is generally viewed as a back up for the homologous AChE and to act as a scavenger for anticholinesterase compounds [<xref ref-type="bibr" rid="B5">5</xref>].</p>
      <p>The presence of ChEs in tissues that are not cholinergically innervated provides the most compelling evidence for the view that AChE and BChE may have functions, other than the termination of cholinergic neurotransmission. There is considerable body of evidence to suggest that ChEs may be involved in embryonic neural development, including a role in cell proliferation, differentiation and cell adhesion [<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B7">7</xref>]. ChEs may also have a causative/permissive role in various pathological conditions as exemplified by the overexpression of ChE genes in various types of tumours and presence of abnormal levels of ChEs with altered properties in Alzheimer's disease [<xref ref-type="bibr" rid="B8">8</xref>, <xref ref-type="bibr" rid="B9">9</xref>]. The histochemical staining of esterase activity on ChE developed by Koelle and Friedenwald [<xref ref-type="bibr" rid="B10">10</xref>] and modified by Karnovsky and Roots [<xref ref-type="bibr" rid="B11">11</xref>] has been extensively used to elucidate the functions of ChEs, examine their tissue specificity, developmental alterations and pathological changes from many species [<xref ref-type="bibr" rid="B2">2</xref>].</p>
      <p>Other than the predominant choline esterase activity, ChEs also display a genuine aryl acylamidase (AAA) activity capable of hydrolysing the synthetic substrate <italic>o</italic>-nitroacetanilide into <italic>o</italic>-nitroaniline and acetate [<xref ref-type="bibr" rid="B12">12</xref>]. Apart from being strongly inhibited by choline esters and classical ChE inhibitors, this AAA activity is susceptible to selective inhibition by 5-hydroxytryptamine (serotonin) [<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B13">13</xref>, <xref ref-type="bibr" rid="B14">14</xref>]. The characteristic feature of the AAA activity associated with human serum BChE is its several fold activation by tyramine [<xref ref-type="bibr" rid="B12">12</xref>]. The natural substrate or the precise physiological role of the AAA activity on ChEs is not known.</p>
      <p>Studies on the tissue specific and developmental regulations/alterations of AAA on ChEs have not been attempted so far partly due to the lower specific activity of the AAA activity on ChEs and mainly due to the absence of a specific method to visualise this activity. In the present paper, a method to visualise the AAA activity on ChEs in polyacrylamide gels using human serum BChE and electric eel AChE as models is described.</p>
    </sec>
    <sec>
      <title>Results and discussion</title>
      <p>The principle of the staining procedure is depicted in Figure <xref ref-type="fig" rid="F1">1</xref>. The AAA on ChEs acts on ONAA to release acetate and o-nitroaniline. <italic>o</italic>-nitroaniline then reacts with nitrous acid (provided by the reaction of sodium nitrite with HCl) at about 0°C yielding the corresponding diazonium compound. The reaction mixture must be kept very cold during the process, otherwise the diazonium compound may be partially hydrolysed to the corresponding phenol. The diazonium compound then complexes with NED to form purple coloured azo dye complex. This coupling reaction is an electrophilic substitution reaction [<xref ref-type="bibr" rid="B15">15</xref>].</p>
      <fig position="float" id="F1">
        <label>Figure 1</label>
        <caption>
          <p>Scheme representing the principle of staining of the AAA actitvity.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-3-1"/>
      </fig>
      <p>The concentrations of sodium nitrite and HCl in the staining solution were found to be critical, since the generated nitrous acid is the one that reacts with <italic>o</italic>-nitroaniline to form the diazonium compound. For optimal detection of the AAA activity, a concentration of 0.1 % (w/v) sodium nitrite and 1 N HCl were found to be required. Similarly, studies with varying concentration of NED indicated that the maximum intensity of colour developed was with 0.75 % (w/v) of the colouring reagent.</p>
      <p>The stained gel pattern for AAA on AChE/BChE using the above protocol is shown in Figure <xref ref-type="fig" rid="F2">2</xref>. It has been shown that the AAA activities on both AChE and BChE can be visualised by this method. Further, selective staining for the AAA activities on either BChE or AChE in a sample containing both these enzymes has been demonstrated by the use of the specific inhibitors of BChE and AChE, namely, tetraisopropyl pyrophosphoramide (iso-OMPA) and 1,5-bis(4 Allyldimethylammoniumphenyl) pentan-3-one dibromide (BW 248c51), respectively. In addition, the intensity of staining increased linearly with the enzyme concentration (in terms of AAA activity) applied in the gel (Figure <xref ref-type="fig" rid="F3">3</xref>). From Figure <xref ref-type="fig" rid="F3">3</xref>, it is also clear that, to visualise a recognisable AAA activity band in the gel, at least 0.07 U of the enzyme is required.</p>
      <fig position="float" id="F2">
        <label>Figure 2</label>
        <caption>
          <p>Differential staining for the AAA activities on ChEs from eel AChE and human serum BChE. Electrophoresis was performed on 3.5% native polyacrylamide gel slabs under non-denaturing conditions as detailed in 'Materials and methods'. All lanes were loaded with 1 U each of AAA on eel AChE and AAA on human serum BChE . After electrophoresis, 'A' was incubated in substrate solution without any inhibitor; 'B' was incubated in substrate solution containing 100 μM of iso-OMPA; and 'C' was incubated in substrate solution containing 100 μM of BW 284c51. After incubation for 40 min, the gels were stained for the AAA activity. The upper and lower arrows denote the AAA activity due to BChE and AChE, respectively.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-3-2"/>
      </fig>
      <fig position="float" id="F3">
        <label>Figure 3</label>
        <caption>
          <p>Effect of enzyme concentration (in terms of AAA activity) on the intensity of staining. Electrophoresis was performed on 3.5% native polyacrylamide gel as described under 'Materials and methods'. Lanes 1-5, respectively, corresponds to 0.07 U, 0.14 U, 0.21 U, 0.28 U and 0.35 U of AAA activity on BChE. After electrophoresis, the gel was stained for the AAA activity as given under 'Materials and Methods'.</p>
        </caption>
        <graphic xlink:href="1471-2091-1-3-3"/>
      </fig>
      <p>Prolonged incubation of the stained gels in the acid solution caused a rapid decrease in the intensity of the purple colour bands. Treating the gels with 0.3 M TCA for 30 min at 4°C prevents this loss in colour. The stain was further fixed in the gels by changing the pH to alkaline side with Tris-HCl buffer, pH 8.6. The colour of the bands changed from purple to brick red (Figure <xref ref-type="fig" rid="F4">4-A</xref>) upon changing the pH from acid to alkaline side. The gels can be stored for weeks in this alkaline buffer without loss in the intensity of the bands. Documentation of the stored gels, if necessary, can be done after treating the gels with 0.3 M TCA which brings back the original purple colour, but with a bluish tint (Figure <xref ref-type="fig" rid="F4">4-B</xref>).</p>
      <fig position="float" id="F4">
        <label>Figure 4</label>
        <caption>
          <p>Effect of storage condition on the colour of the activity band developed using NED. After electrophoresis (of 1 U each of AAA on eel AChE and AAA on human serum BChE) under non-denaturing conditions, the gel was stained for AAA activity as described under 'Materials and methods'. The stained gel was then treated with 0.3 M TCA and stored in Tris-HCl Buffer, pH 8.6, where upon the colour of the band changes from purple to brick red (<bold>A</bold>). The characteristic purple colour, with a blue tint is regained by treating the gel once again with the TCA solution (<bold>B</bold>).</p>
        </caption>
        <graphic xlink:href="1471-2091-1-3-4"/>
      </fig>
      <p>α-Naphthol and β-naphthol were also tried as colouring agents instead of NED. In alkaline conditions, α-naphthol produced a red coloured band, while β-naphthol produced an orange coloured band (Figure not given). When compared to the colour developed with NED, the colour developed with either of the naphthols was faint and diffused. Moreover, the fixing of the stain in the gels was also difficult.</p>
      <p>The AAA activities, other than those associated with cholinesterases (like those found in human liver, rat serum, pineal gland) and amidases that utilise <italic>o</italic>-nitroacetanilide as substrate can be visualised by the method described above. This method would also allow detection of such activities in crude tissue extracts, however, a minimum of 0.07 U of the enzyme has to be loaded per well to clearly visualise the activity in gels, which is the limit of detectability of this method.</p>
    </sec>
    <sec>
      <title>Conclusion</title>
      <p>This study describes a novel method to visualise the AAA activity on ChEs in polyacrylamide gels. The method has been shown to be sensitive and also can selectively detect either of the ChE's AAA activity. Use of this method to visualise AAA activity in tissue sections, however, needs further refinement/modifications to enhance the sensitivity. This is because, any tissue, at a particular locus might not have AAA activity to the extent of 0.07 U. Nevertheless, this study is the first successful attempt to visualise the AAA activity on cholinesterase <italic>in vitro</italic>.</p>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and methods</title>
      <sec sec-type="materials">
        <title>Materials</title>
        <p>N-(1-napthyl)ethylenediamine (NED) was procured from E.Merck, Darmstadt, Germany. iso-OMPA and BW 284c51 were from Sigma Chemical Co., St. Louis, USA. All other chemicals and reagents were of analytical grade and of the highest purity available. <italic>o</italic>-Nitroacetanilide was prepared as described in reference 16.</p>
      </sec>
      <sec>
        <title>Enzymes</title>
        <p>Human serum BChE was purified to apparent homogeneity as previously described [<xref ref-type="bibr" rid="B17">17</xref>]. Electric eel AChE (product No. C 3389) was procured from Sigma Chemical Co., St. Louis, USA.</p>
        <p>The AAA activity on ChEs was assayed using <italic>o</italic>-nitroacetanilide (ONAA) as described in a previous report [<xref ref-type="bibr" rid="B16">16</xref>]. One unit of AAA activity is defined as the quantity of the enzyme required to liberate 1 μmole of <italic>o</italic>-nitroaniline in 1 hr under the standard assay conditions.</p>
      </sec>
      <sec>
        <title>Staining procedure</title>
        <p>Electrophoresis of ChEs were performed in 3.5% native polyacrylamide gel slabs under non-denaturing conditions according to Davis <italic>et al.</italic> [<xref ref-type="bibr" rid="B18">18</xref>]. After electrophoresis, the gels were stained for the AAA activity as follows. The gels were incubated in the substrate solution (10 mM ONAA in 0.1 M potassium phosphate buffer, pH 7.0) for 45 min at 40°C. The gels were transferred from the substrate solution to ice-cold staining solution of 1 N HCl containing 0.1% freshly prepared sodium nitrite and agitated briefly. Then 150 mg (final concentration 0.75% w/v) of N-(1-napthyl)ethylenediamine was added and the gels were gently agitated until sufficient intensity of the characteristic purple colour bands developed. The gels were then transferred to 0.3 M trichloroacetic acid (TCA) and kept for 30 min at 4°C. The gels were finally washed with 0.1 M Tris-HCl buffer, pH 8.6 and stored in the same buffer in a refrigerator. Differential staining for AChE AAA activity was performed by incubating the gels in the substrate solution containing 100 μM iso-OMPA to inhibit the AAA on BChE. Alternatively, in order to visualise BChE AAA activity, gels were incubated in substrate solution containing 100 μM BW 284c51 to inhibit the AAA on AChE.</p>
      </sec>
    </sec>
    <sec>
      <title>Acknowledgements</title>
      <p>The support by Defence Research &amp; Development Establishment (DRDE), Gwalior, India (Project ID No. TC/05414/DRDE/Project-DRDE-149, dated 23 June, 1998) and the award of Senior Research Fellowship to L.J. by the Council of Scientific and Industrial Research, India, and DRDE are gratefully acknowledged.</p>
    </sec>
    <sec>
      <title>Abbreviations</title>
      <p>AAA, aryl acylamidase; AChE, acetylcholinesterase; BChE, butyrlycholinesterase; BW 284c51, 1,5-bis(4-Allyldimethylammoniumphenyl) pentan-3-one dibromide; ChE, cholinesterase; iso-OMPA, tetraisopropyl pyrophosphoramide; NED, N-(1-napthyl)ethylenediamine; ONAA, <italic>o</italic>-nitrooacetanilide; TCA, trichloroaceticacid.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <ref id="B1">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Quinn</surname>
              <given-names>DM</given-names>
            </name>
          </person-group>
          <article-title>Enzyme structure, reaction, dynamics, and virtual transition states.</article-title>
          <source>Chem Rev</source>
          <year>1987</year>
          <volume>87</volume>
          <fpage>955</fpage>
          <lpage>979</lpage>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Soreq</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Zakut</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <article-title>Human Cholinesterases and Anticholinesterases.</article-title>
          <source>Academic Press</source>
          <year>1993</year>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Austin</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Berry</surname>
              <given-names>WK</given-names>
            </name>
          </person-group>
          <article-title>Two selective inhibitors of cholinesterase.</article-title>
          <source>Biochem J</source>
          <year>1953</year>
          <volume>54</volume>
          <fpage>695</fpage>
          <lpage>700</lpage>
          <pub-id pub-id-type="pmid">13058976</pub-id>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Silver</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title>The Biology of Cholinesterases.</article-title>
          <source>Amsterdam: Elsevier</source>
          <year>1974</year>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schwarz</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Glick</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Loewensten</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Soreq</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <article-title>Engineering of human cholinesterases explains and predicts diverse consequences of administration of various drugs and poisons.</article-title>
          <source>Pharmacol Ther</source>
          <year>1995</year>
          <volume>67</volume>
          <fpage>283</fpage>
          <lpage>322</lpage>
          <pub-id pub-id-type="pmid">7494866</pub-id>
          <pub-id pub-id-type="doi">10.1016/0163-7258(95)00019-D</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Layer</surname>
              <given-names>PG</given-names>
            </name>
            <name>
              <surname>Willbold</surname>
              <given-names>E</given-names>
            </name>
          </person-group>
          <article-title>Cholinesterases in Avian Neurogenesis.</article-title>
          <source>Intel Rev Cytol</source>
          <year>1994</year>
          <volume>151</volume>
          <fpage>139</fpage>
          <lpage>181</lpage>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Layer</surname>
              <given-names>PG</given-names>
            </name>
            <name>
              <surname>Ebert</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Treskatis</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Weikert</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Willbold</surname>
              <given-names>E</given-names>
            </name>
          </person-group>
          <article-title>Glycosylated inactive forms of chicken butyrylcholinesterasesand their possible functions.</article-title>
          <source>In Enzymes of the Cholinesterase Family, Edited by DM Quinn, AS Balasubramainan, BP Doctor and P Taylor New York: Plenum Press</source>
          <year>1995</year>
          <fpage>427</fpage>
          <lpage>434</lpage>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Geula</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Mesulam</surname>
              <given-names>MM</given-names>
            </name>
          </person-group>
          <article-title>Cholinesterase and the Pathology of Alzheimer's Disease, Alzheimer's Disease &amp; Related Diseases</article-title>
          <year>1995</year>
          <volume>Suppl 2, 9</volume>
          <fpage>23</fpage>
          <lpage>28</lpage>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Soreq</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Lapidot-Lifson</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Zakut</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <article-title>A Role for Cholinesterases in Tumorigenesis?</article-title>
          <source>Cancer Cell</source>
          <year>1991</year>
          <volume>3</volume>
          <fpage>511</fpage>
          <lpage>516</lpage>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Koelle</surname>
              <given-names>GB</given-names>
            </name>
            <name>
              <surname>Friedenwald</surname>
              <given-names>JS</given-names>
            </name>
          </person-group>
          <article-title>A histochemical method for localizing cholinesterase activity.</article-title>
          <source>Proc Soc Exp Biol Med</source>
          <year>1949</year>
          <volume>70</volume>
          <fpage>617</fpage>
          <lpage>622</lpage>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Karnovsky</surname>
              <given-names>MJ</given-names>
            </name>
            <name>
              <surname>Roots</surname>
              <given-names>L</given-names>
            </name>
          </person-group>
          <article-title>A "direct colouring" thiocholine method for cholinesterases.</article-title>
          <source>J Histochem Cytochem</source>
          <year>1964</year>
          <volume>12</volume>
          <fpage>219</fpage>
          <lpage>221</lpage>
          <pub-id pub-id-type="pmid">14187330</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Balasubramainan</surname>
              <given-names>AS</given-names>
            </name>
            <name>
              <surname>Banumathy</surname>
              <given-names>CD</given-names>
            </name>
          </person-group>
          <article-title>Noncholinergic functions of cholinesterases.</article-title>
          <source>FASEB J</source>
          <year>1993</year>
          <volume>7</volume>
          <fpage>1354</fpage>
          <lpage>1358</lpage>
          <pub-id pub-id-type="pmid">8224608</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fujimoto</surname>
              <given-names>D</given-names>
            </name>
          </person-group>
          <article-title>Serotonin sensitive aryl acylamidase activity of acetylcholinesterase.</article-title>
          <source>FEBS Lett</source>
          <year>1976</year>
          <volume>71</volume>
          <fpage>121</fpage>
          <lpage>123</lpage>
          <pub-id pub-id-type="pmid">992080</pub-id>
          <pub-id pub-id-type="doi">10.1016/0014-5793(76)80912-X</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Weitnauer</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Robitizki</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Layer</surname>
              <given-names>PG</given-names>
            </name>
          </person-group>
          <article-title>Aryl acylamidase activity exhibited by butyrylcholinesterase is higher in chick than in horse, but much lower than in fetal calf serum.</article-title>
          <source>Neurosci Lett</source>
          <year>1998</year>
          <volume>254</volume>
          <fpage>153</fpage>
          <lpage>156</lpage>
          <pub-id pub-id-type="pmid">10214980</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0304-3940(98)00689-2</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Furniss</surname>
              <given-names>BS</given-names>
            </name>
            <name>
              <surname>Hannaford</surname>
              <given-names>AJ</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>PWG</given-names>
            </name>
            <name>
              <surname>Tatchell</surname>
              <given-names>AR</given-names>
            </name>
          </person-group>
          <article-title>Vogel's Textbook of Practical Organic Chemistry.</article-title>
          <source>London: Addision Weseley Longman Limited</source>
          <year>1989</year>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>George</surname>
              <given-names>ST</given-names>
            </name>
            <name>
              <surname>Balasubramanian</surname>
              <given-names>AS</given-names>
            </name>
          </person-group>
          <article-title>The Aryl Acylamidase and Their Relationship to Cholinesterases in Human Serum, Erythrocyte and Liver.</article-title>
          <source>Eur J Biochem</source>
          <year>1981</year>
          <volume>121</volume>
          <fpage>177</fpage>
          <lpage>186</lpage>
          <pub-id pub-id-type="pmid">7035166</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Boopathy</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Balasubramanian</surname>
              <given-names>AS</given-names>
            </name>
          </person-group>
          <article-title>Chemical modification of bifunctional human serum pseudocholinesterase: Effect on the pseudocholinesterase and aryl acylamidase activities.</article-title>
          <source>Eur J Biochem</source>
          <year>1985</year>
          <volume>151</volume>
          <fpage>351</fpage>
          <lpage>360</lpage>
          <pub-id pub-id-type="pmid">2863142</pub-id>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Davis</surname>
              <given-names>BJ</given-names>
            </name>
          </person-group>
          <article-title>Disc electrophoresis. II. Method and application to human serum proteins.</article-title>
          <source>Ann NY Acad Sci</source>
          <year>1964</year>
          <volume>121</volume>
          <fpage>404</fpage>
          <lpage>427</lpage>
          <pub-id pub-id-type="pmid">14240539</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record><record><header><identifier>oai:pubmedcentral.nih.gov:31329</identifier><datestamp>2001-05-11</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">31329</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-2-1</article-id>
      <article-id pub-id-type="pmid">11242564</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-2-1</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Plasma lipases and lipid transfer proteins increase phospholipid but not free cholesterol transfer from lipid emulsion to high density lipoproteins.</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" contrib-type="author">
          <name>
            <surname>Nunes</surname>
            <given-names>Valéria S</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>lipideq@usp.br</email>
        </contrib>
        <contrib id="A2" contrib-type="author">
          <name>
            <surname>Quintão</surname>
            <given-names>Eder CR</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>quintao@originet.com.br</email>
        </contrib>
        <contrib id="A3" contrib-type="author">
          <name>
            <surname>Cazita</surname>
            <given-names>Patrícia M</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>pmcazita@hotmail.com</email>
        </contrib>
        <contrib id="A4" contrib-type="author">
          <name>
            <surname>Harada</surname>
            <given-names>Lila M</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>lilamh@usp.br</email>
        </contrib>
        <contrib id="A5" contrib-type="author">
          <name>
            <surname>de Faria</surname>
            <given-names>Eliana C</given-names>
          </name>
          <xref ref-type="aff" rid="I2">2</xref>
          <email>cotta@fcm.unicamp.br</email>
        </contrib>
        <contrib id="A6" corresp="yes" contrib-type="author">
          <name>
            <surname>Oliveira</surname>
            <given-names>Helena CF</given-names>
          </name>
          <xref ref-type="aff" rid="I3">3</xref>
          <email>ho98@unicamp.br</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Lipid Laboratory, University of São Paulo Medical School, São Paulo,  Brazil</aff>
      <aff id="I2"><label>2</label>Dept. Clinical Pathology, State University of Campinas (UNICAMP), Campinas, São Paulo, Brazil</aff>
      <aff id="I3"><label>3</label>Dept. Physiology and Biophysics, State University of Campinas (UNICAMP), Campinas, São Paulo, Brazil</aff>
      <pub-date pub-type="collection">
        <year>2001</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>20</day>
        <month>2</month>
        <year>2001</year>
      </pub-date>
      <volume>2</volume>
      <fpage>1</fpage>
      <lpage>1</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/2/1"/>
      <history>
        <date date-type="received">
          <day>29</day>
          <month>11</month>
          <year>2000</year>
        </date>
        <date date-type="accepted">
          <day>20</day>
          <month>2</month>
          <year>2001</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2001 Nunes et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2001</copyright-year>
        <copyright-holder>Nunes et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>Plasma lipases and lipid transfer proteins are involved in the generation and speciation of high density lipoproteins. In this study we have examined the influence of plasma lipases and lipid transfer protein activities on the transfer of free cholesterol (FC) and phospholipids (PL) from lipid emulsion to human, rat and mouse lipoproteins. The effect of the lipases was verified by incubation of labeled (<sup>3</sup>H-FC,<sup>14</sup>C-PL) triglyceride rich emulsion with human plasma (control, post-heparin and post-heparin plus lipase inhibitor), rat plasma (control and post-heparin) and by the injection of the labeled lipid emulsion into control and heparinized functionally hepatectomized rats.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>In vitro, the lipase enriched plasma stimulated significantly the transfer of <sup>14</sup>C-PL from emulsion to high density lipoprotein (p&lt;0.001) but did not modify the transfer of <sup>3</sup>H-FC. In hepatectomized rats, heparin stimulation of intravascular lipolysis increased the plasma removal of <sup>14</sup>C-PL and the amount of <sup>14</sup>C-PL found in the low density lipoprotein density fraction but not in the high density lipoprotein density fraction. The in vitro and in vivo experiments showed that free cholesterol and phospholipids were transferred from lipid emulsion to plasma lipoproteins independently from each other. The incubation of human plasma, control and control plus monoclonal antibody anti-cholesteryl ester transfer protein (CETP), with <sup>14</sup>C-PL emulsion showed that CETP increases <sup>14</sup>C-PL transfer to human HDL, since its partial inhibition by the anti-CETP antibody reduced significantly the <sup>14</sup>C-PL transfer (p&lt;0.05). However, comparing the nontransgenic (no CETP activity) with the CETP transgenic mouse plasma, no effect of CETP on the <sup>14</sup>C-PL distribution in mice lipoproteins was observed.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>It is concluded that: 1-intravascular lipases stimulate phospholipid transfer protein mediated phospholipid transfer, but not free cholesterol, from triglyceride rich particles to human high density lipoproteins and rat low density lipoproteins and high density lipoproteins; 2-free cholesterol and phospholipids are transferred from triglyceride rich particles to plasma lipoproteins by distinct mechanisms, and 3 - CETP also contributes to phospholipid transfer activity in human plasma but not in transgenic mice plasma, a species which has high levels of the specific phospholipid transfer protein activity.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>There have been plenty of epidemiological, clinical and experimental evidence that plasma high density lipoproteins levels are inversely correlated with the risk of atherosclerosis [<xref ref-type="bibr" rid="B1">1</xref>,<xref ref-type="bibr" rid="B2">2</xref>]. The contribution of enzymes and proteins associated with HDL to its process of generation and maturation have been extensively studied, both in vitro and in vivo.</p>
      <p>The plasma cholesteryl ester transfer protein (CETP) modulates HDL levels and composition. It mediates the transfer of cholesteryl ester (CE) from HDL to triglyceride (TG) rich lipoproteins (LP), while TG is transferred in the opposite direction, to HDL. One way CE transfer from HDL to LDL may also occur [<xref ref-type="bibr" rid="B3">3</xref>]. CETP also promotes phospholipid (PL) transfer to human HDL [<xref ref-type="bibr" rid="B4">4</xref>,<xref ref-type="bibr" rid="B5">5</xref>,<xref ref-type="bibr" rid="B6">6</xref>]. CETP activity has been directly correlated with LDL cholesterol levels and inversely correlated with HDL cholesterol levels in human plasma [<xref ref-type="bibr" rid="B3">3</xref>,<xref ref-type="bibr" rid="B7">7</xref>].</p>
      <p>PLTP, a specific phospholipid transfer protein, has been identified in human plasma [<xref ref-type="bibr" rid="B8">8</xref>,<xref ref-type="bibr" rid="B9">9</xref>] and in plasma of other vertebrate species [<xref ref-type="bibr" rid="B10">10</xref>]. It promotes the PL transfer from VLDL to HDL [<xref ref-type="bibr" rid="B11">11</xref>]. In addition to PL, PLTP transfers free cholesterol (FC) from PL/FC vesicles to HDL, although with a low efficiency [<xref ref-type="bibr" rid="B12">12</xref>]. Both, CETP and PLTP, can promote HDL remodelling. While CETP, together with hepatic lipoprotein lipase, stimulates the generation of small alpha-HDL, PLTP favours the emergence of large alpha-HDL particles [<xref ref-type="bibr" rid="B13">13</xref>]. Significantly higher levels of HDL-cholesterol were observed in human PLTP transgenic mice [<xref ref-type="bibr" rid="B14">14</xref>]. Furthermore, overexpression of human PLTP produced by recombinant adenovirus injection into mice, resulted in increased levels of prebeta-HDL, increased fractional catabolic rate and liver uptake of CE and PL from HDL [<xref ref-type="bibr" rid="B15">15</xref>].</p>
      <p>After intravascular hydrolysis of TG rich LP by lipoprotein lipase (LPL), surface remnant components such as FC, PL and apoproteins may provide substrates for generation or modification of plasma HDL. Net transfer of PL and FC from chylomicrons and VLDL to HDL has previously been demonstrated in rats [<xref ref-type="bibr" rid="B16">16</xref>,<xref ref-type="bibr" rid="B17">17</xref>] and in human plasma after a fat meal [<xref ref-type="bibr" rid="B18">18</xref>,<xref ref-type="bibr" rid="B19">19</xref>] or during lipolysis [<xref ref-type="bibr" rid="B11">11</xref>]. The contribution of the lipolysed LP components to HDL formation has been reinforced by several studies where the activity of the enzyme lipoprotein lipase LPL was shown to correlate with HDL cholesterol levels in human plasma [<xref ref-type="bibr" rid="B20">20</xref>,<xref ref-type="bibr" rid="B21">21</xref>,<xref ref-type="bibr" rid="B22">22</xref>]. However, changes in the HDL-cholesterol concentration have not been observed in mice overexpressing LPL [<xref ref-type="bibr" rid="B23">23</xref>] or in LPL heterozygous knockout mice [<xref ref-type="bibr" rid="B24">24</xref>].</p>
      <p>The metabolism of HDL in rats and mice differs significantly from that in humans. Part of the species differences observed in mice and in rats may result from their high levels of circulating lipases [<xref ref-type="bibr" rid="B25">25</xref>,<xref ref-type="bibr" rid="B26">26</xref>], lack of CETP [<xref ref-type="bibr" rid="B27">27</xref>] and high levels of PLTP [<xref ref-type="bibr" rid="B10">10</xref>]. Clee et al. [<xref ref-type="bibr" rid="B28">28</xref>] have shown that, in double transgenic mice overexpressing LPL and CETP, HDL cholesterol levels were significantly influenced by the LPL activity while no such correlation was observed in the absence of CETP expression.</p>
      <p>In this study we have further evaluated the influence of plasma lipases and CETP on the free cholesterol and phospholipid transfer from triglyceride rich lipid emulsion similar to chylomicrons [<xref ref-type="bibr" rid="B29">29</xref>,<xref ref-type="bibr" rid="B30">30</xref>] to human, rat and mouse lipoproteins, <italic>in vitro</italic> and <italic>in vivo</italic>.</p>
    </sec>
    <sec>
      <title>Results</title>
      <p>The influence of the intravascular lipase activity on the phospholipids (PL) and free cholesterol (FC) transfer from lipid emulsion (EM) to plasma lipoproteins was evaluated in human control plasma, in lipase-enriched post-heparin plasma and in post-heparin plasma containing a lipase inhibitor, tetrahydrolipstatin (THL) [<xref ref-type="bibr" rid="B34">34</xref>]. PL transfer was determined after 30 minutes of incubation because Tall et al. [<xref ref-type="bibr" rid="B8">8</xref>] have demonstrated that PL net transfer reaches the maximum after this incubation period. The post-heparin plasma lipoprotein lipase (LPL) and hepatic lipoprotein lipase (HL) activities were 2527 ± 1353 and 3747 ± 2116 nmol of fatty acid/ml/h, respectively. The control and post-heparin + THL plasmas had no detectable lipase activity, showing that 2 mM THL completely inhibited the activities of the lipases present in the post-heparin plasma. Table <xref ref-type="table" rid="T1">1</xref> shows that <sup>14</sup>C-PL was preferentially transferred to HDL (p&lt;0.001) while <sup>3</sup>H-FC was equally distributed to LDL and HDL fractions under all 3 plasma conditions. The transfer of <sup>14</sup>C-PL from EM to HDL was significantly stimulated (+60%) by the increase in the lipases' activities in the post-heparin plasma (p&lt;0.001). This stimulation of the PL transfer was abolished in the presence of THL (p&lt;0.01). Considering that HL also has phospholipase activity, the integrity of the phospholipid transferred to HDL was checked by thin layer chromatography. Ninety eight % of the <sup>14</sup>C-PL was recovered in the PL band and no radioactivity was detected in the fatty acid bands. The proportion of <sup>3</sup>H-FC and <sup>14</sup>C-PL found in HDL (0.4) was different from that found in LDL (2.3) or in the EM (1.5), which suggests that these components of the EM were independently transferred to the LP fractions and not as a surface unit detached from the lipolysed EM.</p>
      <table-wrap position="float" id="T1">
        <label>Table 1</label>
        <caption>
          <p>Influence of plasma lipases on the <sup>3</sup>H-free cholesterol (FC) and <sup>14</sup>C-phospholipid (PL) transfer from lipid emulsions to the human plasma lipoproteins.</p>
        </caption>
        <table frame="hsides" rules="groups">
          <thead>
            <tr>
              <td align="left">Fractions</td>
              <td align="left">Control</td>
              <td align="left"/>
              <td align="left">Post-heparin</td>
              <td align="left">Post-heparin +</td>
              <td align="left">THL</td>
              <td align="left"/>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td/>
              <td align="left"><sup>3</sup>H-FC</td>
              <td align="left"><sup>14</sup>C-PL</td>
              <td align="left"><sup>3</sup>H-FC</td>
              <td align="left"><sup>14</sup>C-PL</td>
              <td align="left"><sup>3</sup>H-FC</td>
              <td align="left"><sup>14</sup>C-PL</td>
            </tr>
            <tr>
              <td colspan="7">
                <hr/>
              </td>
            </tr>
            <tr>
              <td align="left">LDL</td>
              <td align="left">15</td>
              <td align="left">7</td>
              <td align="left">21</td>
              <td align="left">7</td>
              <td align="left">20</td>
              <td align="left">6</td>
            </tr>
            <tr>
              <td align="left"/>
              <td align="left">(2-35)</td>
              <td align="left">(3-49)</td>
              <td align="left">(15-26)</td>
              <td align="left">(2-13)</td>
              <td align="left">(17-34)</td>
              <td align="left">(1-12)</td>
            </tr>
            <tr>
              <td align="left">HDL</td>
              <td align="left">13</td>
              <td align="left">31<sup>a</sup></td>
              <td align="left">18</td>
              <td align="left">50<sup>a,b</sup></td>
              <td align="left">15</td>
              <td align="left">39<sup>a,c</sup></td>
            </tr>
            <tr>
              <td align="left"/>
              <td align="left">(7-28)</td>
              <td align="left">(18-47)</td>
              <td align="left">(12-36)</td>
              <td align="left">(35-68)</td>
              <td align="left">(8-33)</td>
              <td align="left">(23-48)</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <p>Percent transfer of <sup>3</sup>H-FC and <sup>14</sup>C-PL from lipid emulsion to LDL and HDL obtained from fasting human plasma control, post-heparin with and without addition of a lipase inhibitor, tetrahydrolipstatin (THL) incubated for 30 minutes at zero (ice) and at 37°C. Plasma lipoproteins were fractionated by FPLC. Percent transfer was calculated as the difference between values obtained at 37°C and 0°C. Results are expressed as median (range), n=12. Mann-Whitney test: a: p&lt; 0.001 (HDL vs. LDL) ; b: p&lt;0.001 (post-heparin vs. control) and c: p&lt;0.01 (post-heparin vs. post-heparin+THL).</p>
        </table-wrap-foot>
      </table-wrap>
      <p>The effect of plasma lipases on the PL transfer to HDL was also verified by incubating labeled EM with plasma from control and heparinized rats. Figure <xref ref-type="fig" rid="F1">1</xref> shows the <sup>14</sup>C-PL distribution in the LP fractions at zero (ice) or after 30 minutes at 37°C. In the control rat plasma (Fig. <xref ref-type="fig" rid="F1">1</xref>, upper panel) at time zero, the distribution of <sup>14</sup>C-PL was 60, 13, 22 and 6% for VLDL, LDL, HDL and a fraction smaller than HDL (&lt;HDL), respectively, while after 30 minutes at 37°C, the observed distribution was 22, 14, 57 and 8% for VLDL, LDL, HDL and fraction &lt;HDL, respectively. It is interesting that PL transfer to HDL can be observed even at time zero. This may represent the combination of the spontaneous and facilitated transfer that occurs during and even after loading the reaction mixture to the FPLC column run at room temperature. Furthermore, rat plasma contains circulating lipases [<xref ref-type="bibr" rid="B25">25</xref>,<xref ref-type="bibr" rid="B26">26</xref>] that could be stimulating PL transfer in the control plasma. In the rat post-heparin plasma (Fig. <xref ref-type="fig" rid="F1">1</xref>, lower panel), the <sup>14</sup>C-PL transfer was so much accelerated that the distributions at zero and after 30 minutes of incubation at 37°C were almost identical, that is, 12, 29.5, 32.5 and 26.5% at zero and 7, 31, 29.5 and 32.5% at 37°C for VLDL, LDL, HDL and fraction &lt;HDL, respectively. HDL and the fraction smaller than HDL together accounted for 59 to 62% of the <sup>14</sup>C-PL. Thus, comparing the PL moiety that remained in the emulsion fraction in the control at 37°C (Fig <xref ref-type="fig" rid="F1">1</xref> upper, 22%) with the post-heparin plasma at 37°C (Fig <xref ref-type="fig" rid="F1">1</xref> lower, 7%), we conclude that PL transfer to LDL and HDL fractions is highly stimulated by the enrichment of the rat plasma with the vascular lipases. We did not investigate the chemical nature of the fraction smaller than HDL but we speculate that it derives from HDL phospholipids or from the emulsion surface itself, and might be lysophospholipids/albumin or phospholipids/apo AI complexes.</p>
      <fig position="float" id="F1">
        <label>Figure 1</label>
        <caption>
          <p>Influence of plasma lipases on the distribution of the <sup>14</sup>C-PL from lipid emulsions into rat plasma lipoproteins. Control (upper panel) and heparin treated (lower panel) rat plasmas were incubated with lipid emulsion labeled with <sup>14</sup>C-phospholipids (PL) at zero (on ice) (open triangles) or for 30 minutes at 37°C (closed triangles), and fractionated by fast protein liquid chromatography. Cholesterol mass in each fraction (O.D.500 nm) is shown in the dotted line profile.</p>
        </caption>
        <graphic xlink:href="1471-2091-2-1-1"/>
      </fig>
      <p>In an attempt to evaluate the PL and FC transfer to HDL in a biological system, we injected the radioactive EM (<sup>3</sup>H-PL/<sup>14</sup>C -FC) into anesthetised functionally hepatectomized rats treated with saline (control) or heparin (LPL stimulated). The liver exclusion maneuver was done in order to minimize the differences in the residence time of the emulsion particles in the circulation of the control and LPL stimulated rats. The hepatectomy efficacy was verified by the amount of <sup>3</sup>H-PL found in the livers at the end of the experiments; that was 1% and 3% of the injected dose in control and heparinized animals, respectively. There was a lower recovery of the labeled PL in the plasma of the heparinized animals (∼ 50%) than in control rats (∼ 90%). This suggests that the heparin stimulated lipolysis increased the plasma removal of PL by peripheral tissues. Table <xref ref-type="table" rid="T2">2</xref> shows the distribution of <sup>3</sup>H-PL and <sup>14</sup>C-FC from the EM into the plasma LP of control and heparinized hepatectomized rats. When intravascular lipolysis was stimulated by heparin, there was a 50% reduction of the <sup>3</sup>H-PL content in the chylomicron (CM) + VLDL fraction (d&lt;1.006) and a parallel increase in the LDL fraction that also includes remnant particles (d= 1.006 to 1.063). No significant difference was observed in the amount of <sup>3</sup>H-PL found in the HDL fraction of control and heparinized hepatectomized rats. A similar result was observed in relation to the <sup>14</sup>C-FC distribution, i.e., a reduction trend of <sup>14</sup>C-FC in the CM+VLDL fraction (non significant) and a significant increase of <sup>14</sup>C-FC transfer to the LDL fraction. However, in both cases, control and heparinized animals, the ratio <sup>14</sup>C-FC/<sup>3</sup>H-PL differs markedly in the three LP fractions (Table <xref ref-type="table" rid="T2">2</xref>). This indicates that, in vivo, the redistribution of the two emulsion surface lipids is independent one from another.</p>
      <table-wrap position="float" id="T2">
        <label>Table 2</label>
        <caption>
          <p>Influence of plasma lipases on the distribution of <sup>14</sup>C-free cholesterol (FC) and <sup>3</sup>H-phospholipid (PL) from lipid emulsions to plasma lipoproteins of hepatectomized rats in vivo.</p>
        </caption>
        <table frame="hsides" rules="groups">
          <thead>
            <tr>
              <td align="left">Fractions</td>
              <td align="left" colspan="2">Control</td>
              <td align="left" colspan="2">Heparinized</td>
            </tr>
            <tr>
              <td/>
              <td colspan="4">
                <hr/>
              </td>
            </tr>
            <tr>
              <td/>
              <td align="left"><sup>14</sup>C-FC</td>
              <td align="left"><sup>3</sup>H-PL</td>
              <td align="left"><sup>14</sup>C-FC</td>
              <td align="left"><sup>3</sup>H-PL</td>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td align="left">CM+ VLDL</td>
              <td align="left">61</td>
              <td align="left">36</td>
              <td align="left">47</td>
              <td align="left">16<sup>a</sup></td>
            </tr>
            <tr>
              <td/>
              <td align="left">(53 - 74)</td>
              <td align="left">(27 - 61)</td>
              <td align="left">(43 - 55)</td>
              <td align="left">(14 - 22)</td>
            </tr>
            <tr>
              <td align="left">LDL + remnants</td>
              <td align="left">20</td>
              <td align="left">22</td>
              <td align="left">34<sup>b</sup></td>
              <td align="left">38<sup>c</sup></td>
            </tr>
            <tr>
              <td/>
              <td align="left">(11 - 24)</td>
              <td align="left">(10 - 26)</td>
              <td align="left">(29 - 38)</td>
              <td align="left">(33 - 42)</td>
            </tr>
            <tr>
              <td align="left">HDL</td>
              <td align="left">19</td>
              <td align="left">42</td>
              <td align="left">18</td>
              <td align="left">46</td>
            </tr>
            <tr>
              <td/>
              <td align="left">(15 - 23)</td>
              <td align="left">(29 - 47)</td>
              <td align="left">(14 - 22)</td>
              <td align="left">(40 - 51)</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <p>Percent distribution of <sup>14</sup>C-FC and <sup>3</sup>H-PL from lipid emulsion to VLDL, LDL and HDL plasma fractions from anesthetized hepatectomized rats treated with saline (control) or heparin after 30 minutes of an intra-arterial injection of the labeled emulsion. Lipoprotein fractions were obtained by ultracentrifugation. Results are expressed as median (range), n=4. Mann-Whitney test for heparin vs. control comparisons: a: <sup>3</sup>H-PL - CM+VLDL, p &lt; 0.03; b: <sup>14</sup>C-FC - LDL, p &lt; 0.03; c: <sup>3</sup>H-PL - LDL, p &lt; 0.03.</p>
        </table-wrap-foot>
      </table-wrap>
      <p>In order to verify the influence of CETP in the PL transfer to HDL, labeled emulsion was incubated with human plasma in the presence and absence of monoclonal antibody against CETP (TP2) and with plasma from CETP transgenic and non-transgenic mice. The CETP activity in these plasmas were 38 and 16% of cholesteryl ester transfer (4 h assay) respectively for human plasma without and with TP2, and 5 and 20% of cholesteryl ester transfer (2 h assay), respectively for nontransgenic and human CETP transgenic mice plasma. Table <xref ref-type="table" rid="T3">3</xref> shows that <sup>14</sup>C-PL transfer from lipid emulsion to human HDL was reduced 40% (p&lt;0.005) when CETP activity was inhibited 58%, indicating that CETP has PL transfer activity as previously reported [<xref ref-type="bibr" rid="B5">5</xref>]. However, the <sup>14</sup>C-PL distribution in mice LP after incubation with the <sup>14</sup>C-PL EM was almost identical for CETP transgenic and non-transgenic mice plasma (Fig. <xref ref-type="fig" rid="F2">2</xref>). The human CETP expressed in these mice might not efficiently interact with the endogenous mice HDL. To check this possibility an exogenous assay was performed using human HDL (240 ug cholesterol) as PL acceptor and minimal amounts of CETP transgenic and non-transgenic mice plasma (50 ul) as sources of CETP and of PLTP. Results obtained (data not shown) were identical to those of the endogenous assay (fig. <xref ref-type="fig" rid="F2">2</xref>). Therefore, human CETP in transgenic mice plasma does not contribute to PL transfer to either mice or human HDL.</p>
      <fig position="float" id="F2">
        <label>Figure 2</label>
        <caption>
          <p>Influence of CETP on the distribution of the <sup>14</sup>C-PL from lipid emulsions into mice plasma lipoproteins. Control non-transgenic (upper panel) and CETP transgenic (lower panel) mice plasmas were incubated with lipid emulsion labeled with <sup>14</sup>C-phospholipids (PL) at zero (on ice) (open triangles) or for 30 minutes at 37°C (closed triangles), and fractionated by fast protein liquid chromatography. Cholesterol mass in each fraction (O.D.500 nm) is shown in the dotted line profile.</p>
        </caption>
        <graphic xlink:href="1471-2091-2-1-2"/>
      </fig>
      <table-wrap position="float" id="T3">
        <label>Table 3</label>
        <caption>
          <p>Influence of CETP on the <sup>14</sup>C-phospholipid (PL) transfer from lipid emulsions to the human plasma lipoproteins.</p>
        </caption>
        <table frame="hsides" rules="groups">
          <thead>
            <tr>
              <td align="left">Fractions</td>
              <td align="left">Control</td>
              <td align="left">+TP2</td>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td align="left">LDL</td>
              <td align="left">4 (0 - 6)</td>
              <td align="left">0 (-5 - 1)</td>
            </tr>
            <tr>
              <td align="left">HDL</td>
              <td align="left">30<sup>a</sup> (26 - 38)</td>
              <td align="left">18<sup>a,b</sup> (16 - 27)</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <p>Percent transfer of <sup>14</sup>C-PL from lipid emulsion to LDL and HDL obtained from fasting human plasma without (control) and with CETP monoclonal antibody, TP2, incubated for 30 minutes at zero (ice) and at 37°C. Plasma lipoproteins were fractionated by FPLC. Percent transfer was calculated as the difference between values obtained at 37°C and 0°C. Results are expressed as median (range), n=6. Mann-Whitney test: a: p&lt;0.001 (HDL vs. LDL), b: p&lt;0.05 (TP2 vs. control).</p>
        </table-wrap-foot>
      </table-wrap>
    </sec>
    <sec>
      <title>Discussion</title>
      <p>Several studies, using different experimental approaches, have shown that the transfer of surface components of TG-rich lipoproteins during their intravascular metabolism is important to determine both level and chemical composition of the HDL subfractions. The present work has confirmed and extended previous observations showing that human and rat plasma lipoprotein lipases stimulate PLTP mediated PL transfer from TG-rich particles to HDL but do not influence the FC transfer process. Some of the previous studies [<xref ref-type="bibr" rid="B11">11</xref>,<xref ref-type="bibr" rid="B35">35</xref>,<xref ref-type="bibr" rid="B36">36</xref>,<xref ref-type="bibr" rid="B37">37</xref>,<xref ref-type="bibr" rid="B38">38</xref>] that used purified exogenous lipases in in vitro incubations with isolated LP displayed a potent stimulation of the PL transfer to HDL. In order to prepare a model that would mirror a physiological system more closely, we have used whole plasma and maximal endogenous lipases activity through heparin administration in vivo as well as in vitro. It is possible that other proteins released by heparin in the vascular bed may have played a role in stimulating PL transfer. The role of circulating lipases was confirmed through the use of a lipase inhibitor (THL), which abolished the stimulating effect of lipase-enriched plasma on the PL transfer to HDL (Tab. <xref ref-type="table" rid="T1">1</xref>). According to these experiments it is likely that during fasting state, where no circulating lipases are detectable, all PL transfer results from the action of the lipid transfer proteins, PLTP and CETP, while in a post-prandial state, when lipases expectedly are more active, the PL transfer to HDL could be raised by 60% or more due to a greater substrate supply .</p>
      <p>Noteworthy the in vitro PL transfer to HDL in the basal plasmas of rat (fig. <xref ref-type="fig" rid="F1">1</xref>, 82%) and mouse (fig. <xref ref-type="fig" rid="F2">2</xref>, 57%) was higher than in the human's (Tab. <xref ref-type="table" rid="T1">1</xref>, 31%) and could be ascribed to the high levels of circulating lipases [<xref ref-type="bibr" rid="B26">26</xref>,<xref ref-type="bibr" rid="B39">39</xref>,<xref ref-type="bibr" rid="B40">40</xref>] and PLTP [<xref ref-type="bibr" rid="B10">10</xref>] found in those species. This could also explain the positive correlation between the lipoprotein lipase activity and HDL concentration in human plasma [<xref ref-type="bibr" rid="B20">20</xref>,<xref ref-type="bibr" rid="B21">21</xref>,<xref ref-type="bibr" rid="B22">22</xref>] but not in mice with genetically modified expression of LPL [<xref ref-type="bibr" rid="B23">23</xref>,<xref ref-type="bibr" rid="B24">24</xref>,<xref ref-type="bibr" rid="B28">28</xref>].</p>
      <p>The in vivo studies showed that the EM PL transfer to HDL did not differ in control and in LPL stimulated (heparin treated) hepatectomized rats. Instead, the LDL density fraction was PL enriched in the heparinized animals. This could be explained by several and not exclusive possibilities. First, the lipolysis stimulation by heparin generates more remnants of the EM that would float in the same density range as LDL (1.006 - 1.063). Second, the rat plasma fraction smaller than HDL that appeared in the in vitro incubations with post-heparin plasma (Fig. <xref ref-type="fig" rid="F1">1</xref>) could also occur in vivo and float in the same density range as LDL (1.006 -1.063). In this regard, O'Meara et. al. [<xref ref-type="bibr" rid="B41">41</xref>] had shown that small HDL particles from heparinized hypertriglyceridemic subjects, identified in non-denaturing gel electrophoresis and by electron microscopy, floated after ultracentrifugation in a less dense range. Those authors had considered it an aberrant result of the ultracentrifugation technique. Third, the diminished availability of PL donor particles in the plasma of the heparinized rats (yield of 50%) as compared to control rats (yield of 90%) would be responsible for the apparent lack of stimulation of the PL transfer to the HDL fraction. Finally, other in vivo metabolic fates of PL would compete for the transfer process to plasma HDL particles in LPL stimulated animals.</p>
      <p>The emulsion FC transfer to HDL was about 40% that of PL in both, in vitro (Tab. <xref ref-type="table" rid="T1">1</xref>) and in vivo (Tab. <xref ref-type="table" rid="T2">2</xref>) studies and it was not influenced by increased rate of intravascular lipolysis. These results suggest that the FC transfer is a slower, probably passive, process distinct from the facilitated PL transfer mechanism [<xref ref-type="bibr" rid="B8">8</xref>,<xref ref-type="bibr" rid="B9">9</xref>]. Also, these results challenge the possibility that new HDL particles are made from the EM surface peeling off during lipolysis because the relative PL/FC ratio was higher in HDL than in the CM+VLDL and emulsion fraction. Others also have shown that FC transfer to HDL is a slow process: FC increases in the HDL fraction only 5 to 8 h after a fat meal [<xref ref-type="bibr" rid="B19">19</xref>] or only after 2 h incubation of HDL with VLDL and purified rat heart LPL [<xref ref-type="bibr" rid="B36">36</xref>].</p>
      <p>We have also confirmed previous studies [<xref ref-type="bibr" rid="B5">5</xref>] claiming that PL transfer from TG-rich particles to human HDL is facilitated by CETP, since its partial inhibition significantly reduced the PL transfer (Table <xref ref-type="table" rid="T3">3</xref>). However, human CETP expressed in the transgenic mice plasma had no effect whatsoever on the PL transfer to mouse plasma lipoproteins or to human HDL. This lead us to admit that the mouse plasma PL transfer activity is so potent that some additional protein (CETP) with PL transfer activity would be irrelevant in an already saturated in vitro system.</p>
      <p>In summary, the present findings indicate unequivocally the importance of the intravascular lipolytic mechanisms for the PLTP and CETP facilitated PL, but not FC, transfer process from TG-rich particles to HDL. PL enriched HDL would be more efficient in promoting FC efflux from cell membranes, hence accelerating the reverse cholesterol transport. These may provide the basis for the mechanism that accounts for the inverse correlation between HDL and TG plasma levels found in epidemiological studies in human populations as well as in several circumstances where plasma lipid levels are modified by pharmacological and dietary means.</p>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and Methods</title>
      <sec>
        <title>Lipid emulsions</title>
        <p>Cholesterol (FC), cholesteryl oleate (CO) and triolein (TO) were obtained from NuCheck Prep (Elysian, MN, USA) and lecithin (PL) from Lipid Products (Surrey,UK). They were more than 99% pure as tested by thin layer chromatography. Lipid mixtures (2% FC, 6% CO, 23%PL and 69%TO by weight) together with 130 μCi of L-α-dioleoyl [1-<sup>14</sup>C]-phosphatydylcholine and 25 μCi of [1,2-<sup>3</sup>H(N)]-cholesterol (New England Nuclear, Boston, MA, USA) were sonicated in 2.785 M NaCl solution (d=1.101 g/ml) utilizing a Branson Cell Disruptor (Branson Ultrasonics Corp., Danbury, CT, USA), model B30, 1 cm probe, with continuous output of 70-80 W, at aproximately 55°C, for 30 minutes, under N<sub>2</sub> flow. Triglyceride-rich particles were purified after discontinuous gradient ultracentrifugation of NaCl solutions with densities 1.065, 1.020 and 1.006 g/ml. A first step of 12000 rpm for 15 min in a SW41 Beckman rotor at 22°C was performed to discard the floating coarse lipid. After replacing the 1.006 solution, the gradient was again centrifuged at 36000 rpm, for 30 min at 22°C and the emulsion particles were recovered from the top layer. The lipid emulsion composition achieved was: 1% FC, 4% CO, 14% PL and 81% TO. These particles resemble native chylomicrons [<xref ref-type="bibr" rid="B29">29</xref>]. By gel filtration (FPLC), <sup>3</sup>H-FC, <sup>14</sup>C-PL and triglyceride co-eluted as only one peak corresponding to the plasma VLDL size fraction (fractions # 13 to 17) on a HR 10/30 superose 6 column (Pharmacia Biotech, Uppsala, Sweden).</p>
      </sec>
      <sec>
        <title>Sources of plasma</title>
        <p>Human blood samples from 12 fasted healthy volunteers (5 men and 7 women, total cholesterol and triglycerides &lt; 200 mg/dl), were drawn on EDTA, pre (basal) and 10 min after an I.V. bolus injection of heparin (100 U/kg BW). Male Wistar rats, approximately 300 g, had their carotid arteries cannulated under pentobarbital anesthesia. After recovery, they received saline (control) or heparin (LPL stimulated) and after 10 min they were exsanguinated on EDTA. Adult male C57Bl6 and human CETP transgenic mice (line 5203), derived from the colony of Dr AR Tall's Laboratory (Columbia University, NY, USA) were bled with heparinized hematocrit capillary tubes in the retro-orbital plexus under ketamine anesthesia (Vetarnacol, Konig, SP, Brazil). All plasmas were obtained by centrifugation at 2000 rpm in a Sorval RT6000B refrigerated centrifuge and freshly used.</p>
      </sec>
      <sec>
        <title>Free cholesterol (FC) and phospholipid (PL) transfer assay</title>
        <p>Control and treated plasmas (post-heparin, post-heparin + lipases inhibitor and control + CETP monoclonal antibody, TP2, provided by Dr. AR Tall) were incubated with lipid emulsion (∼ 700 μg of triolein/ml) labeled with <sup>3</sup>H-FC (10<sup>6</sup> dpm/ml) and <sup>14</sup>C-PL (2 × 10<sup>5</sup> dpm/ml) at zero (on ice, "time zero") and for 30 minutes at 37°C. Plasma lipoproteins were next separated by fast protein liquid chromatography (FPLC) as described by Jiao et al. [<xref ref-type="bibr" rid="B31">31</xref>]. Briefly, plasma samples (200 μl) were fractionated on a HR 10/30 Superose 6 column (Pharmacia Biotech, Uppsala, Sweden) using a constant flow of 0.5 ml/min of tris-buffered saline, pH 7.2. Sixty fractions of 0.5 ml were automatically collected. <sup>3</sup>H- and <sup>14</sup>C- dpm of each FPLC fraction was determined by liquid scintilation in a beta counter Beckman LS6000TA. As we have measured only radioactive FC and PL, the term "transfer" is used to describe either net transfer or exchange process among LP. Total cholesterol was also determined in the fractions #10 to 40 by an enzymatic assay in an automatic analyzer Cobas (F. Hoffman-La Roche, Basileia, Switzerland) using Boehringer Mannheim reagents (Mannheim, Germany).</p>
      </sec>
      <sec>
        <title>In Vivo studies</title>
        <p>Male Wistar rats, weighing ∼ 300 g were anesthetised with pentobarbital ip (50 mg/Kg BW). The right carotid artery was cannulated with a PE 50 siliconized catheter and after laparostomy, the liver <italic>hilum</italic> was ligated. Physiologic solution (control) or heparin (250 U/Kg BW) in a final volume of 0.25 ml was injected through the carotid catheter. After 10 minutes, labeled lipid emulsion (4 × 10<sup>5</sup> dpm of <sup>3</sup>H-PL and 7 × 10<sup>5</sup> dpm of <sup>14</sup>C-FC) was injected intra-arterially. After 30 minutes, the animals were exsanguinated by the carotid catheter and plasma lipoproteins were immediately separated by ultracentrifugation in a discontinuous gradient. Plasmas were adjusted to density (d) 1.21 g/ml with solid KBr and overlayed with solutions of d=1.063 and 1.006 g/ml and centrifuged for 24 h in a SW 41 rotor, at 4°C, 100000 × g, in a L8 Beckman ultracentrifuge. Lipoproteins fractions were collected from the top to bottom by vacuum as follow: 1.5 ml VLDL (d&lt;1.006), 2.5 ml LDL (d = 1.006 - 1.063) and 7.5 ml HDL (d&gt;1.063). Radioactivity was determined in aliquots from each lipoprotein fraction.</p>
      </sec>
      <sec>
        <title>Intravascular Lipases Activity</title>
        <p>Total lipase activity was determined according to Ehnholm &amp; Kuusi [<xref ref-type="bibr" rid="B32">32</xref>]. Briefly, overnight fasted human plasmas, collected pre (basal) and 10 minutes after heparin I.V. injection (100 U/Kg body weight), were incubated with a <sup>3</sup>H-triolein/arabic gum substrate ([9,10 <sup>3</sup>H (N)]-triolein, New England Nuclear, Boston, MA) in 0.2 M Tris-HCl buffer, pH 8.5, 37ºC, during 1 hour. Hepatic lipase (HL) activity was determined in tubes where the lipoprotein lipase (LPL) was inhibited by 2 M NaCl. The hydrolyzed labeled free fatty acids were extracted with methanol / chloroform / heptane (1.4 : 1.25 : 1), 0.14 M K<sub>2</sub>CO<sub>3</sub> / H<sub>3</sub>BO<sub>3</sub>, pH 10.5, dried under N<sub>2</sub>, and their radioactivity was determined in a liquid scintillation solution in a LS6000 Beckman Beta Counter. The LPL activity was calculated as the difference between the total lipase and the hepatic lipase activities.</p>
      </sec>
      <sec>
        <title>Cholesteryl ester transfer protein activity assay</title>
        <p>A mixture of human VLDL and LDL protein (100 μg) were incubated with 10000 dpm of human HDL<sub>3</sub> labeled with [<sup>14</sup>C]-cholesteryl ester (CE) [<xref ref-type="bibr" rid="B33">33</xref>] and 5 μl of diluted CETP transgenic mice plasma or undiluted human plasma as the source of CETP in a final volume of 100 μl. Blanks were prepared with tris/saline/EDTA buffer (10 mM/140 mM/1 mM), pH 7.4, and negative controls with non-transgenic mice plasma. The incubations were carried out at 37°C for 2 or 4 hours. After these periods, the apo B containing lipoproteins were precipitated using a mixture of 1.6% dextran sulfate / 1 M MgCl<sub>2</sub> solution (1:1) and the radioactivity was measured in the remaining supernatant in scintillation solution Ultima Gold (Eastman Kodak Co., NY) in a LS6000 Beckman Beta Counter. The % CE transferred from [<sup>14</sup>C]-CE-HDL to VLDL+LDL was calculated as: (dpm in the blank tube - dpm in the plasma sample / dpm in the blank tube) × 100.</p>
      </sec>
      <sec>
        <title>Statistical analysis</title>
        <p>All comparisons were analysed by the non-parametric Mann-Whitney test using the GraphPad Prism, version 2.01 (1996) program. Differences were considered significant when p&lt;0.05.</p>
      </sec>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgements</title>
        <p>We are grateful to Dr. Alan R. Tall for kindly providing some human CETP transgenic mice and the CETP monoclonal antibody, TP2. This study was supported by Brazilian grants from FAPESP, CNPq and Pronex/FINEP. V.S.N was a MSc Student in the program of the Dept of Biochemistry, Escola Paulista de Medicina da Universidade Federal de São Paulo, SP, Brasil.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="B1">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Backer</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Bacquer</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Konitzer</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <article-title>Epidemiological aspects of high density lipoprotein cholesterol.</article-title>
          <source>Atherosclerosis</source>
          <year>1998</year>
          <volume>137</volume>
          <fpage>S1</fpage>
          <lpage>S6</lpage>
          <pub-id pub-id-type="pmid">9694534</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0021-9150(97)00310-9</pub-id>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Stein</surname>
              <given-names>O</given-names>
            </name>
            <name>
              <surname>Stein</surname>
              <given-names>Y</given-names>
            </name>
          </person-group>
          <article-title>Atheroprotective mechanisms of HDL.</article-title>
          <source>Atherosclerosis</source>
          <year>1999</year>
          <volume>144</volume>
          <fpage>285</fpage>
          <lpage>301</lpage>
          <pub-id pub-id-type="pmid">10407490</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0021-9150(99)00065-9</pub-id>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tall</surname>
              <given-names>AR</given-names>
            </name>
          </person-group>
          <article-title>Plasma lipid transfer proteins.</article-title>
          <source>Annu Rev Biochem</source>
          <year>1995</year>
          <volume>64</volume>
          <fpage>235</fpage>
          <lpage>257</lpage>
          <pub-id pub-id-type="pmid">7574481</pub-id>
          <pub-id pub-id-type="doi">10.1146/annurev.biochem.64.1.235</pub-id>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hesler</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Tall</surname>
              <given-names>AR</given-names>
            </name>
            <name>
              <surname>Swenson</surname>
              <given-names>TL</given-names>
            </name>
            <name>
              <surname>Weech</surname>
              <given-names>PK</given-names>
            </name>
            <name>
              <surname>Marcel</surname>
              <given-names>YL</given-names>
            </name>
            <name>
              <surname>Milne</surname>
              <given-names>RW</given-names>
            </name>
          </person-group>
          <article-title>Monoclonal antibody to the M<sub>r</sub> 74000 cholesterol ester transfer protein neutralize all of the cholesterol ester and triglyceride transfer activities in human plasma.</article-title>
          <source>J Biol Chem</source>
          <year>1988</year>
          <volume>263</volume>
          <fpage>5020</fpage>
          <lpage>5023</lpage>
          <pub-id pub-id-type="pmid">3281933</pub-id>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Swenson</surname>
              <given-names>TL</given-names>
            </name>
            <name>
              <surname>Brocia</surname>
              <given-names>RW</given-names>
            </name>
            <name>
              <surname>Tall</surname>
              <given-names>AR</given-names>
            </name>
          </person-group>
          <article-title>Plasma cholesteryl ester transfer protein has binding sites for neutral lipids and phospholipids.</article-title>
          <source>J Biol Chem</source>
          <year>1988</year>
          <volume>263</volume>
          <fpage>5150</fpage>
          <lpage>5157</lpage>
          <pub-id pub-id-type="pmid">2833496</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lagrost</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Athias</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Gambert</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Lallemant</surname>
              <given-names>C</given-names>
            </name>
          </person-group>
          <article-title>Comparative study of phospholipid transfer activities mediated by cholesteryl ester transfer protein and phospholipid transfer protein.</article-title>
          <source>J Lipid Res</source>
          <year>1994</year>
          <volume>35</volume>
          <fpage>825</fpage>
          <lpage>835</lpage>
          <pub-id pub-id-type="pmid">8071605</pub-id>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tato</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Vega</surname>
              <given-names>GL</given-names>
            </name>
            <name>
              <surname>Grundy</surname>
              <given-names>SM</given-names>
            </name>
          </person-group>
          <article-title>Determinants of plasma HDL-cholesterol in hypertriglyceridemic patients.</article-title>
          <source>Arterioscler Thromb Vasc Biol</source>
          <year>1997</year>
          <volume>17</volume>
          <fpage>56</fpage>
          <lpage>63</lpage>
          <pub-id pub-id-type="pmid">9012638</pub-id>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tall</surname>
              <given-names>AR</given-names>
            </name>
            <name>
              <surname>Forester</surname>
              <given-names>LR</given-names>
            </name>
            <name>
              <surname>Bongiovanni</surname>
              <given-names>GL</given-names>
            </name>
          </person-group>
          <article-title>Facilitation of phosphatidylcholine transfer into HDL lipoproteins by an apolipoprotein in the density 1.20 - 1.26 g/ml fraction of plasma.</article-title>
          <source>J Lipid Res</source>
          <year>1983</year>
          <volume>24</volume>
          <fpage>277</fpage>
          <lpage>289</lpage>
          <pub-id pub-id-type="pmid">6842084</pub-id>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Albers</surname>
              <given-names>JJ</given-names>
            </name>
            <name>
              <surname>Tollefson</surname>
              <given-names>JH</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>CH</given-names>
            </name>
            <name>
              <surname>Steinmetz</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title>Isolation and characterization of human plasma lipid transfer proteins.</article-title>
          <source>Arteriosclerosis</source>
          <year>1984</year>
          <volume>4</volume>
          <fpage>49</fpage>
          <lpage>58</lpage>
          <pub-id pub-id-type="pmid">6691846</pub-id>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Guyard-Dangremont</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Desrumaux</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Gambert</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Lallemant</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Lagrost</surname>
              <given-names>L</given-names>
            </name>
          </person-group>
          <article-title>Phospholipid and cholesteryl ester transfer activities in plasma from 14 vertebrate species. Relation to atherogenesis susceptibility.</article-title>
          <source>Comp Biochem Physiol Biochem Mol Biol</source>
          <year>1998</year>
          <volume>120</volume>
          <fpage>517</fpage>
          <lpage>525</lpage>
          <pub-id pub-id-type="doi">10.1016/S0305-0491(98)10038-X</pub-id>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tall</surname>
              <given-names>AR</given-names>
            </name>
            <name>
              <surname>Krumholz</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Olivecrona</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Deckelbaum</surname>
              <given-names>RJ</given-names>
            </name>
          </person-group>
          <article-title>Plasma phospholipid transfer protein enhances transfer and exchange of phospholipids between VLDL and HDL lipoproteins during lipolysis.</article-title>
          <source>J Lipid Res</source>
          <year>1985</year>
          <volume>26</volume>
          <fpage>842</fpage>
          <lpage>851</lpage>
          <pub-id pub-id-type="pmid">4031662</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nishida</surname>
              <given-names>HI</given-names>
            </name>
            <name>
              <surname>Nishida</surname>
              <given-names>T</given-names>
            </name>
          </person-group>
          <article-title>Phospholipid transfer protein mediates transfer of not only phosphatidylcholine but also cholesterol from phosphatidylcholine-cholesterol vesicles to high density lipoproteins.</article-title>
          <source>J Biol Chem</source>
          <year>1997</year>
          <volume>272</volume>
          <fpage>6959</fpage>
          <lpage>6964</lpage>
          <pub-id pub-id-type="pmid">9054384</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.272.11.6959</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lagrost</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Desrumaux</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Masson</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Deckert</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Gambert</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <article-title>Structure and function of the plasma phospholipid transfer protein.</article-title>
          <source>Curr Opin Lipidol</source>
          <year>1998</year>
          <volume>9</volume>
          <fpage>203</fpage>
          <lpage>209</lpage>
          <pub-id pub-id-type="pmid">9645502</pub-id>
          <pub-id pub-id-type="doi">10.1097/00041433-199806000-00004</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Albers</surname>
              <given-names>JJ</given-names>
            </name>
            <name>
              <surname>Tu</surname>
              <given-names>AY</given-names>
            </name>
            <name>
              <surname>Paigen</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Cheung</surname>
              <given-names>MC</given-names>
            </name>
            <name>
              <surname>Marcovina</surname>
              <given-names>SM</given-names>
            </name>
          </person-group>
          <article-title>Transgenic mice expressing human phospholipid transfer protein have increased HDL/non-HDL cholesterol ratio.</article-title>
          <source>Int J Clin Lab Res</source>
          <year>1996</year>
          <volume>26</volume>
          <fpage>262</fpage>
          <lpage>267</lpage>
          <pub-id pub-id-type="pmid">9007618</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Foger</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Santamarina-Fojo</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Shamburek</surname>
              <given-names>RD</given-names>
            </name>
            <name>
              <surname>Parrot</surname>
              <given-names>CL</given-names>
            </name>
            <name>
              <surname>Talley</surname>
              <given-names>GD</given-names>
            </name>
            <name>
              <surname>Brewer</surname>
              <given-names>HB</given-names>
              <suffix>Jr</suffix>
            </name>
          </person-group>
          <article-title>Plasma phospholipid transfer protein. Adenovirus-mediated overexpression in mice leads to decreased plasma high density lipoprotein (HDL) and enhanced hepatic uptake of phospholipids and cholesteryl esters from HDL.</article-title>
          <source>J Biol Chem</source>
          <year>1997</year>
          <volume>272</volume>
          <fpage>27393</fpage>
          <lpage>27400</lpage>
          <pub-id pub-id-type="pmid">9341191</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.272.43.27393</pub-id>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Redgrave</surname>
              <given-names>TG</given-names>
            </name>
            <name>
              <surname>Small</surname>
              <given-names>DM</given-names>
            </name>
          </person-group>
          <article-title>Quantitation of the transfer of surface phospholipid of chylomicrons to the HDL lipoprotein fraction during the catabolism of chylomicrons in the rat.</article-title>
          <source>J Clin Invest</source>
          <year>1979</year>
          <volume>64</volume>
          <fpage>162</fpage>
          <lpage>171</lpage>
          <pub-id pub-id-type="pmid">221542</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tall</surname>
              <given-names>AR</given-names>
            </name>
            <name>
              <surname>Green</surname>
              <given-names>PH</given-names>
            </name>
            <name>
              <surname>Glickman</surname>
              <given-names>RM</given-names>
            </name>
            <name>
              <surname>Riley</surname>
              <given-names>JW</given-names>
            </name>
          </person-group>
          <article-title>Metabolic fate of chylomicron phospholipids and apoproteins in the rat.</article-title>
          <source>J Clin Invest</source>
          <year>1979</year>
          <volume>64</volume>
          <fpage>977</fpage>
          <lpage>989</lpage>
          <pub-id pub-id-type="pmid">225354</pub-id>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tall</surname>
              <given-names>AR</given-names>
            </name>
            <name>
              <surname>Blum</surname>
              <given-names>CB</given-names>
            </name>
            <name>
              <surname>Forester</surname>
              <given-names>GP</given-names>
            </name>
            <name>
              <surname>Nelson</surname>
              <given-names>CA</given-names>
            </name>
          </person-group>
          <article-title>Changes in the distribution and composition of plasma HDL liproteins after ingestion of fat.</article-title>
          <source>J Biol Chem</source>
          <year>1982</year>
          <volume>257</volume>
          <fpage>198</fpage>
          <lpage>207</lpage>
          <pub-id pub-id-type="pmid">6796585</pub-id>
        </citation>
      </ref>
      <ref id="B19">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Groot</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Scheek</surname>
              <given-names>LM</given-names>
            </name>
          </person-group>
          <article-title>Effects of fat ingestion on HDL profiles in human sera.</article-title>
          <source>J Lipid Res</source>
          <year>1984</year>
          <volume>25</volume>
          <fpage>684</fpage>
          <lpage>692</lpage>
          <pub-id pub-id-type="pmid">6481243</pub-id>
        </citation>
      </ref>
      <ref id="B20">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Brunzell</surname>
              <given-names>JD</given-names>
            </name>
          </person-group>
          <article-title>Familial lipoprotein lipase deficiency and other causes of the chylomicronemia syndrome</article-title>
          <source>Scriver, CR, Beaudet, AL, Sly, WS, ed Metabolic &amp; Molecular Bases of Inherited Disease McGraw-Hill Inc, New York, 7th ed,</source>
          <year>1995</year>
          <fpage>1913</fpage>
          <lpage>1932</lpage>
        </citation>
      </ref>
      <ref id="B21">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bijvoet</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Gagne</surname>
              <given-names>SE</given-names>
            </name>
            <name>
              <surname>Moorjani</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Gagne</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Henderson</surname>
              <given-names>HE</given-names>
            </name>
            <name>
              <surname>Fruchart</surname>
              <given-names>JC</given-names>
            </name>
            <name>
              <surname>Dallongeville</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Alaupovic</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Prins</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Kastelein</surname>
              <given-names>JJ</given-names>
            </name>
            <name>
              <surname>Hayden</surname>
              <given-names>MR</given-names>
            </name>
          </person-group>
          <article-title>Alterations in plasma lipoproteins and apolipoproteins before the age of 40 in heterozygotes for lipoprotein lipase deficiency.</article-title>
          <source>J Lipid Res</source>
          <year>1996</year>
          <volume>37</volume>
          <fpage>640</fpage>
          <lpage>650</lpage>
          <pub-id pub-id-type="pmid">8728325</pub-id>
        </citation>
      </ref>
      <ref id="B22">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kuusi</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Ehnholm</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Viikari</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Harkonen</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Vartiainen</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Puska</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Taskinen</surname>
              <given-names>M-R</given-names>
            </name>
          </person-group>
          <article-title>Postheparin plasma lipoprotein and hepatic lipase are determinants of hypo- and hyperalphalipoproteinemia.</article-title>
          <source>J Lipid Res</source>
          <year>1989</year>
          <volume>30</volume>
          <fpage>1117</fpage>
          <lpage>1126</lpage>
          <pub-id pub-id-type="pmid">2504859</pub-id>
        </citation>
      </ref>
      <ref id="B23">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Jirik</surname>
              <given-names>FR</given-names>
            </name>
            <name>
              <surname>LeBoeuf</surname>
              <given-names>RC</given-names>
            </name>
            <name>
              <surname>Henderson</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Castellani</surname>
              <given-names>LW</given-names>
            </name>
            <name>
              <surname>Lusis</surname>
              <given-names>AJ</given-names>
            </name>
            <name>
              <surname>Ma</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Forsythe</surname>
              <given-names>IJ</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Kirk</surname>
              <given-names>E</given-names>
            </name>
          </person-group>
          <article-title>Alteration of lipid profiles in plasma of transgenic mice expressing human lipoprotein lipase.</article-title>
          <source>J Biol Chem</source>
          <year>1994</year>
          <volume>269</volume>
          <fpage>11417</fpage>
          <lpage>11424</lpage>
          <pub-id pub-id-type="pmid">8157673</pub-id>
        </citation>
      </ref>
      <ref id="B24">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Weinstock</surname>
              <given-names>PH</given-names>
            </name>
            <name>
              <surname>Bisgaier</surname>
              <given-names>CL</given-names>
            </name>
            <name>
              <surname>Aalto-Setala</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Radner</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Ramakrishnan</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Levak-Frank</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Essenburg</surname>
              <given-names>AD</given-names>
            </name>
            <name>
              <surname>Zechner</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Breslow</surname>
              <given-names>JL</given-names>
            </name>
          </person-group>
          <article-title>Severe hypertriglyceridemia, reduced high density lipoprotein, and neonatal death in lipoprotein lipase knockout mice. Mild hypertriglyceridemia with impaired very low density lipoprotein clearance in heterozygotes.</article-title>
          <source>J Clin Invest</source>
          <year>1995</year>
          <volume>96</volume>
          <fpage>2555</fpage>
          <lpage>2568</lpage>
          <pub-id pub-id-type="pmid">8675619</pub-id>
        </citation>
      </ref>
      <ref id="B25">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Applebaum-Bowden</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Kobayashi</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Kashyap</surname>
              <given-names>VS</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>DR</given-names>
            </name>
            <name>
              <surname>Berard</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Meyn</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Parrott</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Maeda</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Shamburek</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Brewer</surname>
              <given-names>HB</given-names>
              <suffix>Jr</suffix>
            </name>
            <name>
              <surname>Santamarina-Fojo</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Hepatic lipase gene therapy in hepatic lipase-deficient mice. Adenovirus-mediated replacement of a lipolytic enzyme to the vascular endothelium.</article-title>
          <source>J Clin Invest</source>
          <year>1996</year>
          <volume>97</volume>
          <fpage>799</fpage>
          <lpage>805</lpage>
          <pub-id pub-id-type="pmid">8609237</pub-id>
        </citation>
      </ref>
      <ref id="B26">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gillett</surname>
              <given-names>MP</given-names>
            </name>
            <name>
              <surname>Vieira</surname>
              <given-names>EM</given-names>
            </name>
            <name>
              <surname>Dimenstein</surname>
              <given-names>R</given-names>
            </name>
          </person-group>
          <article-title>The phospholipase activities present in preheparin mouse plasma are inhibited by antiserum to hepatic lipase.</article-title>
          <source>Int J Biochem</source>
          <year>1993</year>
          <volume>25</volume>
          <fpage>449</fpage>
          <lpage>453</lpage>
          <pub-id pub-id-type="pmid">8462732</pub-id>
          <pub-id pub-id-type="doi">10.1016/0020-711X(93)90639-V</pub-id>
        </citation>
      </ref>
      <ref id="B27">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ha</surname>
              <given-names>YC</given-names>
            </name>
            <name>
              <surname>Barter</surname>
              <given-names>PJ</given-names>
            </name>
          </person-group>
          <article-title>Differences in plasma cholesteryl ester transfer activity in sixteen vertebrate species.</article-title>
          <source>Comp Biochem Physiol B</source>
          <year>1982</year>
          <volume>71</volume>
          <fpage>265</fpage>
          <lpage>269</lpage>
          <pub-id pub-id-type="pmid">7060347</pub-id>
          <pub-id pub-id-type="doi">10.1016/0305-0491(82)90252-8</pub-id>
        </citation>
      </ref>
      <ref id="B28">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Clee</surname>
              <given-names>SM</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Bissada</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Miao</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Ehrenborg</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Benlian</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Shen</surname>
              <given-names>GX</given-names>
            </name>
            <name>
              <surname>Angel</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>LeBoeuf</surname>
              <given-names>RC</given-names>
            </name>
            <name>
              <surname>Hayden</surname>
              <given-names>MR</given-names>
            </name>
          </person-group>
          <article-title>Relationship between lipoprotein lipase and HDL lipoprotein cholesterol in mice: modulation by cholesteryl ester transfer protein and dietary status.</article-title>
          <source>J Lipid Res</source>
          <year>1997</year>
          <volume>38</volume>
          <fpage>2079</fpage>
          <lpage>2089</lpage>
          <pub-id pub-id-type="pmid">9374130</pub-id>
        </citation>
      </ref>
      <ref id="B29">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Oliveira</surname>
              <given-names>HCF</given-names>
            </name>
            <name>
              <surname>Hirata</surname>
              <given-names>MH</given-names>
            </name>
            <name>
              <surname>Redgrave</surname>
              <given-names>TG</given-names>
            </name>
            <name>
              <surname>Maranhão</surname>
              <given-names>RC</given-names>
            </name>
          </person-group>
          <article-title>Competition between chylomicrons and their remnants for plasma removal: a study with artificial emulsion models of chylomicrons.</article-title>
          <source>Biochim Biophys Acta</source>
          <year>1988</year>
          <volume>958</volume>
          <fpage>211</fpage>
          <lpage>217</lpage>
          <pub-id pub-id-type="pmid">3337836</pub-id>
          <pub-id pub-id-type="doi">10.1016/0005-2760(88)90179-8</pub-id>
        </citation>
      </ref>
      <ref id="B30">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nakandakare</surname>
              <given-names>ER</given-names>
            </name>
            <name>
              <surname>Lottenberg</surname>
              <given-names>SA</given-names>
            </name>
            <name>
              <surname>Oliveira</surname>
              <given-names>HCF</given-names>
            </name>
            <name>
              <surname>Bertolami</surname>
              <given-names>MC</given-names>
            </name>
            <name>
              <surname>Vasconcelos</surname>
              <given-names>KS</given-names>
            </name>
            <name>
              <surname>Sperotto</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Quintão</surname>
              <given-names>EC</given-names>
            </name>
          </person-group>
          <article-title>Simultaneous measurements of chylomicron lipolysis and remnant removal using a doubly labeled artificial lipid emulsion: studies in normolipidemic and hyperlipidemic subjects.</article-title>
          <source>J Lipid Res</source>
          <year>1994</year>
          <volume>35</volume>
          <fpage>143</fpage>
          <lpage>152</lpage>
          <pub-id pub-id-type="pmid">8138715</pub-id>
        </citation>
      </ref>
      <ref id="B31">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jiao</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Cole</surname>
              <given-names>TG</given-names>
            </name>
            <name>
              <surname>Kitchens</surname>
              <given-names>RT</given-names>
            </name>
            <name>
              <surname>Pfleger</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Schonfeld</surname>
              <given-names>G</given-names>
            </name>
          </person-group>
          <article-title>Genetic heterogeneity of lipoproteins in inbred strains of mice: analysis by gel-permeation chromatography.</article-title>
          <source>Metabolism</source>
          <year>1990</year>
          <volume>39</volume>
          <fpage>155</fpage>
          <lpage>160</lpage>
          <pub-id pub-id-type="pmid">2299988</pub-id>
        </citation>
      </ref>
      <ref id="B32">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ehnholm</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Kuusi</surname>
              <given-names>T</given-names>
            </name>
          </person-group>
          <article-title>Preparation, characterization and measurement of hepatic lipase.</article-title>
          <source>Methods Enzymol</source>
          <year>1986</year>
          <volume>129</volume>
          <fpage>716</fpage>
          <lpage>738</lpage>
          <pub-id pub-id-type="pmid">3724551</pub-id>
        </citation>
      </ref>
      <ref id="B33">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Oliveira</surname>
              <given-names>HCF</given-names>
            </name>
            <name>
              <surname>Quintão</surname>
              <given-names>EC</given-names>
            </name>
          </person-group>
          <article-title>'In vitro' cholesteryl ester bidirectional flow between high-density lipoproteins and triglyceride-rich emulsions: effects of particle concentration and composition, cholesteryl ester transfer activity and oleic acid.</article-title>
          <source>J Biochem Biophys Methods</source>
          <year>1996</year>
          <volume>32</volume>
          <fpage>45</fpage>
          <lpage>57</lpage>
          <pub-id pub-id-type="pmid">8773547</pub-id>
          <pub-id pub-id-type="doi">10.1016/0165-022X(94)00060-Q</pub-id>
        </citation>
      </ref>
      <ref id="B34">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Huff</surname>
              <given-names>MW</given-names>
            </name>
            <name>
              <surname>Miller</surname>
              <given-names>DB</given-names>
            </name>
            <name>
              <surname>Wolf</surname>
              <given-names>BM</given-names>
            </name>
            <name>
              <surname>Connelly</surname>
              <given-names>PW</given-names>
            </name>
            <name>
              <surname>Sawyez</surname>
              <given-names>CG</given-names>
            </name>
          </person-group>
          <article-title> Uptake of hypertriglyceridemic VLDL and their remnants by HepG2 cells: the role of lipoprotein lipase, hepatic triglyceride lipase, and cell surface proteoglycans.</article-title>
          <source>J Lipid Res</source>
          <year>1997</year>
          <volume>38</volume>
          <fpage>1318</fpage>
          <lpage>1333</lpage>
          <pub-id pub-id-type="pmid">9254059</pub-id>
        </citation>
      </ref>
      <ref id="B35">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Marques-Vidal</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Jauhiainen</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Metso</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Ehnholm</surname>
              <given-names>C</given-names>
            </name>
          </person-group>
          <article-title>Transformation of HDL2 particles by hepatic lipase and phospholipid transfer protein.</article-title>
          <source>Atherosclerosis</source>
          <year>1997</year>
          <volume>133</volume>
          <fpage>87</fpage>
          <lpage>96</lpage>
          <pub-id pub-id-type="pmid">9258411</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0021-9150(97)00120-2</pub-id>
        </citation>
      </ref>
      <ref id="B36">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Murdoch</surname>
              <given-names>SJ</given-names>
            </name>
            <name>
              <surname>Breckenridge</surname>
              <given-names>WC</given-names>
            </name>
          </person-group>
          <article-title>Effect of lipid transfer proteins on lipoprotein lipase induced transformation of VLDL and HDL.</article-title>
          <source>Biochim Biophys Acta</source>
          <year>1996</year>
          <volume>1303</volume>
          <fpage>222</fpage>
          <lpage>232</lpage>
          <pub-id pub-id-type="pmid">8908157</pub-id>
          <pub-id pub-id-type="doi">10.1016/0005-2760(96)00105-1</pub-id>
        </citation>
      </ref>
      <ref id="B37">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Murdoch</surname>
              <given-names>SJ</given-names>
            </name>
            <name>
              <surname>Breckenridge</surname>
              <given-names>WC</given-names>
            </name>
          </person-group>
          <article-title>Influence of lipoprotein lipase and hepatic lipase on the transformation of VLDL and HDL during lipolysis of VLDL.</article-title>
          <source>Atherosclerosis</source>
          <year>1995</year>
          <volume>118</volume>
          <fpage>193</fpage>
          <lpage>212</lpage>
          <pub-id pub-id-type="pmid">8770314</pub-id>
          <pub-id pub-id-type="doi">10.1016/0021-9150(95)05606-8</pub-id>
        </citation>
      </ref>
      <ref id="B38">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Patsch</surname>
              <given-names>JR</given-names>
            </name>
            <name>
              <surname>Gotto</surname>
              <given-names>AM</given-names>
              <suffix>Jr</suffix>
            </name>
            <name>
              <surname>Olivercrona</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Eisenberg</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Formation of HDL<sub>2</sub>- like particles during lipolysis of VLDL <italic>in vitro.</italic></article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1978</year>
          <volume>75</volume>
          <fpage>4519</fpage>
          <lpage>4523</lpage>
          <pub-id pub-id-type="pmid">212757</pub-id>
        </citation>
      </ref>
      <ref id="B39">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gillett</surname>
              <given-names>MP</given-names>
            </name>
            <name>
              <surname>Costa</surname>
              <given-names>EM</given-names>
            </name>
            <name>
              <surname>Owen</surname>
              <given-names>JS</given-names>
            </name>
          </person-group>
          <article-title>The phospholipase activities present in preheparin mouse plasma are inhibited by antiserum to hepatic lipase.</article-title>
          <source>Biochim Biophys Acta</source>
          <year>1980</year>
          <volume>617</volume>
          <fpage>237</fpage>
          <lpage>244</lpage>
          <pub-id pub-id-type="pmid">7357019</pub-id>
          <pub-id pub-id-type="doi">10.1016/0005-2760(80)90166-6</pub-id>
        </citation>
      </ref>
      <ref id="B40">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Peterson</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Bengtsson-Olivecrona</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Olivecrona</surname>
              <given-names>T</given-names>
            </name>
          </person-group>
          <article-title>Mouse preheparin plasma contains high levels of hepatic lipase with low affinity for heparin.</article-title>
          <source>Biochim Biophys Acta</source>
          <year>1986</year>
          <volume>87</volume>
          <fpage>865</fpage>
          <lpage>870</lpage>
        </citation>
      </ref>
      <ref id="B41">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>O'Meara</surname>
              <given-names>NM</given-names>
            </name>
            <name>
              <surname>Cabana</surname>
              <given-names>VG</given-names>
            </name>
            <name>
              <surname>Lukens</surname>
              <given-names>JR</given-names>
            </name>
            <name>
              <surname>Loharikar</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Forte</surname>
              <given-names>TM</given-names>
            </name>
            <name>
              <surname>Polonsky</surname>
              <given-names>KS</given-names>
            </name>
            <name>
              <surname>Getz</surname>
              <given-names>GS</given-names>
            </name>
          </person-group>
          <article-title>Heparin-induced lipolysis in hypertriglyceridemic subjects results in the formation of atypical HDL particle.</article-title>
          <source>J Lipid Res</source>
          <year>1994</year>
          <volume>35</volume>
          <fpage>2178</fpage>
          <lpage>2190</lpage>
          <pub-id pub-id-type="pmid">7897316</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record><record><header><identifier>oai:pubmedcentral.nih.gov:31330</identifier><datestamp>2001-05-11</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">31330</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-2-2</article-id>
      <article-id pub-id-type="pmid">11299049</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-2-2</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Osmotic stress-dependent serine phosphorylation of the histidine kinase homologue DokA</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" contrib-type="author">
          <name>
            <surname>Oehme</surname>
            <given-names>Felix</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <xref ref-type="aff" rid="I2">2</xref>
          <email>felix.oehme.fo@bayer-ag.de</email>
        </contrib>
        <contrib id="A2" corresp="yes" contrib-type="author">
          <name>
            <surname>Schuster</surname>
            <given-names>Stephan C</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <xref ref-type="aff" rid="I3">3</xref>
          <email>stephan.schuster@tuebingen.mpg.de</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Max-Planck-Institut für Biochemie, 82152 Martinsried, Germany</aff>
      <aff id="I2"><label>2</label>Bayer AG Institut für Herz-Kreislaufforschung, D-42096 Wuppertal Germany</aff>
      <aff id="I3"><label>3</label>Max-Planck-Institut für Entwicklungsbiologie, D-72076 Tübingen, Germany</aff>
      <pub-date pub-type="collection">
        <year>2001</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>16</day>
        <month>3</month>
        <year>2001</year>
      </pub-date>
      <volume>2</volume>
      <fpage>2</fpage>
      <lpage>2</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/2/2"/>
      <history>
        <date date-type="received">
          <day>14</day>
          <month>2</month>
          <year>2001</year>
        </date>
        <date date-type="accepted">
          <day>16</day>
          <month>3</month>
          <year>2001</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2001 Oehme and Schuster; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2001</copyright-year>
        <copyright-holder>Oehme and Schuster; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>Two-component systems consisting of histidine kinases and their corresponding receivers are widespread in bacterial signal transduction. In the past few years, genes coding for homologues of two-component systems were also discovered in eukaryotic organisms. DokA, a homologue of bacterial histidine kinases, is an element of the osmoregulatory pathway in the amoeba <italic>Dictyostelium</italic>. The work described here addresses the question whether DokA is phosphorylated <italic>in vivo</italic> in response to osmotic stress.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>We have endogenously overexpressed individual domains of DokA to investigate post-translational modification of the protein in response to osmotic shock <italic>in vivo</italic>. <italic>Dictyostelium</italic> cells were labeled with [<sup>32</sup>P]-orthophosphate, exposed to osmotic stress and DokA fragments were subsequently isolated by immunoprecipitation. Thus, a stress-dependent phosphorylation could be demonstrated, with the site of phosphorylation being located in the kinase domain. We demonstrate biochemically that the phosphorylated amino acid is serine, and by mutational analysis that the phosphorylation reaction is not due to an autophosphorylation of DokA. Furthermore, mutation of the conserved histidine did not affect the osmostress-dependent phosphorylation reaction.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>A stimulus-dependent serine phosphorylation of a eukaryotic histidine kinase homologue was demonstrated for the first time <italic>in vivo</italic>. That implies that DokA, although showing typical structural features of a bacterial two-component system, might be part of a eukaryotic signal transduction pathway that involves serine/threonine kinases.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>Two-component systems are central elements of the bacterial signaling circuitry [<xref ref-type="bibr" rid="B1">1</xref>]. Signal transduction by these systems usually involves autophosphorylation of a histidine kinase on a conserved histidine residue and subsequent transfer of the phosphoryl group to a conserved aspartate on a receiver domain. Until recently, two-component systems had only been found in bacteria. In the past few years, genes coding for histidine kinase homologues and their corresponding receivers have also been discovered in eukaryotic organisms [for a review see <xref ref-type="bibr" rid="B2">2</xref>]. Most of the corresponding eukaryotic gene products are part of a phosphoryl relay, which consists of a hybrid histidine kinase with a kinase and a receiver domain on the same polypeptide, a histidine phosphotransfer protein and a second receiver as part of a response regulator [<xref ref-type="bibr" rid="B3">3</xref>]. The function of eukaryotic two-component systems as histidine kinases was questionable until Posas <italic>et al.</italic> showed that the <italic>Saccharomyces cerevisiae</italic> gene product Sln1 acts as a histidine kinase <italic>in vitro</italic> and <italic>in vivo</italic> [<xref ref-type="bibr" rid="B4">4</xref>]. More recently, histidine kinase activity of the ethylene receptor Etr1 from <italic>Arabidopsis</italic> was demonstrated <italic>in vitro</italic> [<xref ref-type="bibr" rid="B5">5</xref>]. Further studies showed, however, that eukaryotic two-component systems do not function as independent pathways, but are often connected to serine/threonine- and tyrosine kinase cascades. Thus, the yeast Sln1-Ypd1-Ssk1 phosphoryl relay acts as an osmosensor, which activates a MAP-kinase cascade when cells are exposed to high osmolarity [<xref ref-type="bibr" rid="B6">6</xref>]. The <italic>Dictyostelium discoideum</italic> protein RegA consists of a N-terminal receiver domain and a C-terminal phosphodiesterase domain [<xref ref-type="bibr" rid="B7">7</xref>]. Phosphorylation of the RegA response regulator via a two-component phosphoryl relay in turn activates the RegA phosphodiesterase thereby causing a decrease in the intracellular cAMP level. Eukaryotic phytochromes, another class of histidine kinase homologues, were shown to act as light-regulated serine/threonine kinases <italic>in vitro</italic> instead of acting according to the histidine kinase paradigm [<xref ref-type="bibr" rid="B8">8</xref>]. These results suggest that eukaryotic two-component systems, although being homologues of bacterial histidine kinases and receivers, might show post-translational modifications found in the already established eukaryotic signal transduction systems.</p>
      <p>In the amoeba <italic>Dictyostelium discoideum</italic>, several genes coding for histidine kinases have been described [[<xref ref-type="bibr" rid="B9">9</xref>-<xref ref-type="bibr" rid="B13">13</xref>]]. Deletions of individual histidine kinase genes cause different developmental phenotypes such as rapid aggregation, disproportioned fruiting body and stalk ratios or impaired spore formation [<xref ref-type="bibr" rid="B13">13</xref>]. Moreover, cells lacking the histidine kinase gene <italic>dokA</italic> are osmosensitive, i.e. the viability of these cells is decreased when exposed to high osmolarity for up to two hours [<xref ref-type="bibr" rid="B9">9</xref>]. Given the evidence that DokA is part of the osmotic response system of <italic>Dictyostelium</italic>, we have examined whether DokA shows kinase activity in an osmolarity-dependent manner.</p>
      <p>In this paper, we present evidence that the histidine kinase homologue DokA is phosphorylated on a serine residue <italic>in vivo</italic> when <italic>Dictyostelium</italic> cells are exposed to a high osmolarity medium. We further demonstrate that the phosphorylation site is located in a domain homologous to bacterial histidine kinases and that mutation of the conserved histidine does not affect the serine phosphorylation of DokA.</p>
    </sec>
    <sec>
      <title>Results</title>
      <sec>
        <title>Homologous expression of DokA domains</title>
        <p>In order to investigate the DokA kinase activity <italic>in vivo</italic>, we have overexpressed the individual domains of DokA in <italic>Dictyostelium discoideum</italic> AX2 cells. In previous studies on two-component systems it was shown that the individual domains can be expressed separately, thereby maintaining their biochemical function [<xref ref-type="bibr" rid="B4">4</xref>, <xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B14">14</xref>]. Three fragments of DokA were expressed under the control of a constitutively active actin15 promoter by using the plasmid pDEX-RH [<xref ref-type="bibr" rid="B15">15</xref>]: a 99 kd C-terminal fragment of DokA consisting of two PAS domains [<xref ref-type="bibr" rid="B16">16</xref>], the kinase domain and the receiver domain (PHKR); the 51 kd kinase domain (HK) and the C-terminal 19 kd receiver domain (RR) (Fig. <xref ref-type="fig" rid="F1">1</xref>). Overexpression of these domains can be easily detected by immunostaining of a blotting membrane containing crude extracts from <italic>Dictyostelium</italic> cells which were transformed with the corresponding constructs (Fig. <xref ref-type="fig" rid="F1">1A</xref> and <xref ref-type="fig" rid="F1">1B</xref>). In contrast, wild type DokA, expressed under the control of the endogenous promoter, can not be detected by these methods, as it is only weakly expressed in vegetative cells and in the early stages of development [<xref ref-type="bibr" rid="B9">9</xref>]. The conserved residues of this class of signaling molecules are among others a histidine and an ATP binding motif in the kinase. We have therefore mutated the proposed site of histidine phosphorylation (H1053) in the PHKR (PHKR HQ) and two glycine residues (G 1205, G 1207) which are essential for ATP binding (PHKR GA GA) (Fig. <xref ref-type="fig" rid="F1">1C</xref>).</p>
        <fig position="float" id="F1">
          <label>Figure 1</label>
          <caption>
            <p><bold>Identification of overexpressed DokA fragments.</bold> Cells transformed with the pDEX-RH-<italic>dokA</italic> constructs were lysed in Laemmli sample buffer and subjected to SDS-PAGE. Proteins were blotted onto a PVDF membrane and DokA fragments were detected by immunostaining with the pAb PHKR antibody. The 99 kd fragment PHKR (Panel A, lane 1) and the 19 kd fragment RR (Panel B, lane 1) are expressed at comparable levels whereas the 51 kd fragment HK (Panel A, lane 2) is more weakly expressed. Wild-type DokA in AX2 cell extracts can not be detected (Panel A, lane 3; panel B, lane 2). All constructs used in this work are represented in a schematic drawing (Panel C).</p>
          </caption>
          <graphic xlink:href="1471-2091-2-2-1"/>
        </fig>
      </sec>
      <sec>
        <title>In vivo phosphorylation of DokA</title>
        <p>Because <italic>Dictyostelium</italic> cells lacking the <italic>dokA</italic> gene are sensitive to hyperosmotic stress, it was speculated that DokA is part of the osmotic response system of <italic>Dictyostelium</italic> [<xref ref-type="bibr" rid="B9">9</xref>]. It was, however, not clear whether DokA is phosphorylated <italic>in vivo</italic> in an osmotic stress-dependent manner. To address this question, we cultured <italic>Dictyostelium</italic> cells overexpressing the DokA fragment PHKR in a phosphate-depleted medium and labeled them with [<sup>32</sup>P]-orthophosphate. Labeled cells were osmotically shocked by adding 400 mM sorbitol [<xref ref-type="bibr" rid="B9">9</xref>] and subsequently lysed. Sorbitol was used as osmolyte because it is non-toxic and can not be metabolized by <italic>Dictyostelium</italic> cells. Other osmolytes (e. g. NaCl or glucose) have also been used in previous experiments to demonstrate osmosensitivity of <italic>dokA</italic><sup>-</sup> cells under various hyperosmotic conditions (data not shown). The overexpressed DokA fragment was purified from the cell lysate by immunoprecipitation with a DokA-specific polyclonal antibody (Fig. <xref ref-type="fig" rid="F2">2A</xref>). The precipitate was subjected to SDS-PAGE and blotted onto a PVDF membrane. It was shown by autoradiography that PHKR is phosphorylated during hyperosmotic stress (Fig. <xref ref-type="fig" rid="F2">2A</xref>). The phosphorylation level is maximal 20 min after the onset of the osmotic shock and does not decrease until 40 min thereafter. In cells, which are not osmotically shocked, no phosphorylation of DokA was observed (Fig. <xref ref-type="fig" rid="F2">2B</xref>). We conclude from these results that DokA is phosphorylated <italic>in vivo</italic> in an osmotic stress-dependent manner.</p>
        <fig position="float" id="F2">
          <label>Figure 2</label>
          <caption>
            <p><bold><italic>In vivo</italic> phosphorylation of DokA during osmotic stress.</bold> PHKR was immunoprecipitated from the cell lysate of radioactively labeled and osmotically shocked <italic>Dictyostelium</italic> PHKR cells. Purified proteins were separated by SDS-PAGE, blotted onto a PVDF membrane and subjected to autoradiography. Panel A: PHKR is phosphorylated <italic>in vivo</italic> during osmotic shock (t = 20 min, 40 min). Mutation of the conserved histidine in PHKR does not affect the phosphorylation of PHKR. Before the osmotic shock (t = 0 min), neither of the two DokA fragments are phosphorylated. The radioactive label can not be removed by treating the membrane with 1 N HCl for 1 h. It was shown by immunostaining with the mAb 426/HK antibody that equal amounts of protein were purified at each point in time. Panel B: PHKR precipitated from untreated cells is not radioactively labeled.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-2-2"/>
        </fig>
        <p>Since DokA is a homologue of bacterial histidine kinases, it was probable that the observed radioactive labeling was due to a histidine phosphorylation. We therefore overexpressed a mutated form of PHKR, which lacks the conserved histidine H1053 in AX2 cells. The PHKR H1053Q fragment was, however, also phosphorylated during osmotic shock (Fig. <xref ref-type="fig" rid="F2">2A</xref>). Furthermore, the radioactive label was not removed by acid treatment of the blotting membrane (Fig. <xref ref-type="fig" rid="F2">2A</xref>), indicating that PHKR is not phosphorylated at a histidine. Acid resistance is a typical feature of phosphorylated serine, threonine or tyrosine residues [<xref ref-type="bibr" rid="B17">17</xref>]. Tyrosine phosphorylation of PHKR was excluded by immunostaining with a monoclonal anti-phosphotyrosine antibody (data not shown) and phospho amino acid analysis (Fig. <xref ref-type="fig" rid="F3">3</xref>).</p>
        <fig position="float" id="F3">
          <label>Figure 3</label>
          <caption>
            <p><bold>Phospho-amino acid analysis.</bold> Radioactively labeled PHKR was purified by immunoprecipitation from osmotically shocked <italic>Dictyostelium</italic> cells. The protein was totally hydrolysed by boiling with 6 N HCl at 120°C. Two-dimensional thin-layer electrophoresis was carried out as described [<xref ref-type="bibr" rid="B17">17</xref>]. Phospho-serine was detected by autoradiography.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-2-3"/>
        </fig>
        <p>To distinguish between serine and threonine phosphorylation, we hydrolyzed radioactively labeled PHKR in boiling 6 N hydrochloric acid. The resulting mixture of amino acids was subjected to two-dimensional thin-layer electrophoresis [<xref ref-type="bibr" rid="B17">17</xref>]. Using autoradiography, we were able to show that PHKR is phosphorylated on a serine residue (Fig. <xref ref-type="fig" rid="F3">3</xref>).</p>
      </sec>
      <sec>
        <title>Location of the phosphorylation site</title>
        <p>To determine the domain of DokA in which the phosphorylated serine residue is located, we purified the DokA fragments HK (kinase domain) and RR (receiver domain) from radioactively labeled and osmotically shocked cells overexpressing these fragments. The osmotic stress-dependent phosphorylation of PHKR was also found in case of the HK fragment (Fig. <xref ref-type="fig" rid="F4">4</xref>), whereas significant labeling of the RR fragment was not observed. Again, the phosphorylation of HK was acid-resistant (data not shown). We therefore conclude, that the observed phosphorylation of PHKR is occurring on a serine residue of the kinase domain.</p>
        <fig position="float" id="F4">
          <label>Figure 4</label>
          <caption>
            <p><bold>Location of the phosphorylation site.</bold> The DokA fragment HK (kinase domain) was purified from radioactively labeled and osmotically shocked <italic>Dictyostelium</italic> cells as described above. The HK fragment is strongly phosphorylated during osmotic shock (t = 20 min, 40 min), whereas no phosphorylation was observed before the shock (t = 0 min). It was shown by immunostaining with the mAb 426/HK antibody that equal amounts of protein were purified at each point in time.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-2-4"/>
        </fig>
      </sec>
      <sec>
        <title>Phosphorylation of mutated DokA fragments</title>
        <p>Phosphorylation of DokA during osmotic shock could be the result of an autophosphorylation reaction, as the kinase domain contains sequence motifs, which are homologous to domains of bacterial histidine kinases [<xref ref-type="bibr" rid="B9">9</xref>]. It was previously shown that mutation of two conserved glycine residues in the ATP-binding site of the eukaryotic histidine kinase homologue Etr1 suppresses ATP binding and thus prevents autophosphorylation of Etr1 on a histidine residue [<xref ref-type="bibr" rid="B5">5</xref>]. The two corresponding glycine residues in the DokA kinase domain are G1205 and G1207, respectively. To examine whether DokA is autophosphorylated during osmotic shock, we overexpressed a mutated form of PHKR, in which the conserved glycines were substituted against alanine. Interestingly, the PHKR GA GA fragment is also phosphorylated during osmotic shock (Fig. <xref ref-type="fig" rid="F5">5</xref>). Thus, the observed radioactive labeling of DokA is not the result of an autophosphorylation reaction of the catalytic domain.</p>
        <fig position="float" id="F5">
          <label>Figure 5</label>
          <caption>
            <p><bold><italic>In vivo</italic> phosphorylation of a PHKR fragment with a disabled catalytic domain.</bold> Autoradiography of the PVDF membrane shows that a double mutation in the ATP binding site of PHKR (G1205A, G1207A) does not affect the <italic>in vivo</italic> phosphorylation of PHKR during osmotic shock (t = 10 min, 30 min).</p>
          </caption>
          <graphic xlink:href="1471-2091-2-2-5"/>
        </fig>
      </sec>
    </sec>
    <sec>
      <title>Discussion</title>
      <p>In the past few years, a number of eukaryotic genes coding for histidine kinase homologues have been cloned and characterized. Recent work showed that eukaryotic two-component systems are integrated in signal transduction pathways involving phosphodiesterases and MAP kinases [<xref ref-type="bibr" rid="B6">6</xref>, <xref ref-type="bibr" rid="B7">7</xref>, <xref ref-type="bibr" rid="B18">18</xref>]. The results presented here confirm this idea. By labeling <italic>Dictyostelium</italic> cells with [<sup>32</sup>P]-orthophosphate, we were able to show that overexpressed fragments of the <italic>Dictyostelium</italic> histidine kinase homologue DokA are phosphorylated <italic>in vivo</italic> on a serine residue. The phosphorylation was not present before and steadily increased after the osmotic shock reaching a plateau after 20 min. It should be noted that this phosphorylation reaction was only observed when cells were exposed to a hyperosmotic medium and not as a result of starvation or development.</p>
      <p>The observed serine phosphorylation is in contrast to the classic two-component paradigm, which predicts only histidine and aspartate phosphorylation. However, several recent publications showed post-translational modification on serine and threonine residues, which are not in accordance with the above prediction. In particular, the stimulus-dependent serine/threonine phosphorylation of other eukaryotic histidine kinase homologues was recently demonstrated <italic>in vitro</italic> [<xref ref-type="bibr" rid="B8">8</xref>]. Phytochromes from oat and green algae contain histidine kinase-related domains, but lack the conserved histidine which is essential for autophosphorylation. However, they are able to autophosphorylate on serine/threonine residues when exposed to red light thereby acting as light-regulated protein kinases [<xref ref-type="bibr" rid="B8">8</xref>]. In contrast, the cyanobacterial phytochrome Cph1 acts as a light-regulated histidine kinase [<xref ref-type="bibr" rid="B19">19</xref>]. Considering these differences, oat and algal phytochromes have been designated as serine/threonine kinases with histidine kinase ancestry [<xref ref-type="bibr" rid="B8">8</xref>]. More recently, a sequence motif homologous to histidine kinases without the conserved histidine has been found in the adenylyl cyclase gene <italic>acrA</italic> in <italic>Dictyostelium</italic> [<xref ref-type="bibr" rid="B20">20</xref>].</p>
      <p>It was previously suggested that DokA is part of the osmotic response system of <italic>Dictyostelium,</italic> as mutants lacking the <italic>dokA</italic> gene are sensitive against hyperosmotic stress [<xref ref-type="bibr" rid="B9">9</xref>]. Two-component systems are involved in osmoregulation in a variety of organisms [<xref ref-type="bibr" rid="B6">6</xref>]. In <italic>S. cerevisiae</italic>, the Sln1-Ypd1-Ssk1 phosphoryl relay acts as an osmosensor, which activates a MAP-kinase pathway when cells are exposed to hyperosmotic stress [<xref ref-type="bibr" rid="B6">6</xref>]. In hyperosmotically shocked mammalian cells, MAP-kinases are phosphorylated <italic>in vivo</italic> on threonine and tyrosine residues [<xref ref-type="bibr" rid="B21">21</xref>, <xref ref-type="bibr" rid="B22">22</xref>]. In this respect, DokA resembles typical eukaryotic signal transduction proteins, as hyperosmotic stress causes serine phosphorylation of DokA. The observed osmotic stress-dependent phosphorylation supports the hypothesis that DokA is involved in an osmosensing signal transduction pathway in <italic>Dictyostelium</italic> [<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B23">23</xref>].</p>
      <p>To address the question, whether DokA is phosphorylated in an autophosphorylation reaction, mutations of two conserved glycine residues in the ATP binding pocket of the catalytic domain of the kinase were introduced. The mutation was shown to completely inhibit ATP binding in histidine kinases [<xref ref-type="bibr" rid="B24">24</xref>]. Proteins carrying these mutations are not able to autophosphorylate on the conserved histidine residue [<xref ref-type="bibr" rid="B5">5</xref>]. In contrast, the serine phosphorylation of DokA is not affected by mutation of the conserved glycine residues G1205 and G1207, making an autophosphorylation reaction unlikely. Consistent with this finding is the fact that the mutation of the conserved histidine H1053 has no influence on the serine phosphorylation of DokA, indicating that no histidinyl-phosphate intermediate is necessary for this reaction. A physiologically relevant role of H1053 can, however, not be definitely precluded by this experimental approach as the DokA domains have been expressed in cells which contain a functional <italic>dokA</italic> allele. Interaction of the overexpressed peptides with wild type DokA might also be important for the detection of the osmotic stimulus as the DokA domains used in this work lack the N-terminal input domain [<xref ref-type="bibr" rid="B9">9</xref>]. Taken together, our results imply that DokA is a substrate for another serine/threonine kinase. To address this question, we analyzed the DokA amino acid sequence using the database PhosphoBase (<ext-link ext-link-type="uri" xlink:href="http://www.cbs.dtu.dk/databases/PhosphoBase/"/>) to search for putative phosphorylation sites. More than 50 serine phosphorylation sites were predicted by this algorithm. None of these sites was in the receiver domain, which is consistent with our finding that the phosphorylation site of DokA is located in the kinase domain. The results of the sequence analysis indicate that a number of protein kinases may interact and subsequently phosphorylate DokA. It was previously shown that DokA regulates the activity of the RdeA-RegA pathway, thereby causing a transient intracellular cAMP signal reaching a maximum after 2 min in response to an osmotic shock [<xref ref-type="bibr" rid="B23">23</xref>]. In contrast, the phosphorylation reaction described here shows a 10-fold slower kinetic. We therefore speculate that the serine/threonine kinase which phosphorylates DokA might act downstream of the RdeA-RegA pathway as part of a feedback mechanism. The exact localization of the phosphorylated serine residue is currently under investigation.</p>
    </sec>
    <sec>
      <title>Conclusions</title>
      <p>We have demonstrated an osmotic stress-dependent serine phosphorylation of the eukaryotic histidine kinase homologue DokA <italic>in vivo</italic>. The phosphorylation does not depend on the conserved histidine residue, which is essential for the function of two-component systems and is not due to an autophosphorylation reaction. This confirms the idea that eukaryotic homologues of bacterial signal transduction systems might be integrated in signaling pathways involving serine/threonine kinases.</p>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and Methods</title>
      <sec>
        <title>Chemicals</title>
        <p>Geneticin G 418 and Mes were obtained from Sigma, and sorbitol was from Merck. Yeast extract and peptone were from Oxoid. Radiochemicals were obtained from Amersham. "Complete" protease inhibitor cocktail was from Roche Biochemicals.</p>
      </sec>
      <sec>
        <title>Cell culture</title>
        <p>Amoebae of <italic>Dictyostelium discoideum</italic> strain AX2-214 were grown in AX medium [<xref ref-type="bibr" rid="B25">25</xref>] at 21°C up to a cell density of 3-5 × 10<sup>6</sup> cells/ml. Strains containing the G 418 resistance gene were cultivated in AX medium with 10 μg G 418/ml.</p>
        <p>For <italic>in vivo</italic> phosphorylation experiments, cells were grown up to 5 × 10<sup>6</sup> cells/ml, diluted sevenfold in a phosphate-depleted medium (14.3 g peptone, 7.15 g yeast extract, 18 g maltose in 1 l 20 mM Mes, pH 6.5) and cultivated for 16 h.</p>
      </sec>
      <sec>
        <title>Construction of cell lines</title>
        <p>To create constructs of DokA fragments, the corresponding regions of the <italic>dokA</italic> gene were amplified by PCR using the plasmid pDIC3 [<xref ref-type="bibr" rid="B9">9</xref>]. Primers were constructed to introduce flanking <italic>Eco</italic>RI restriction sites into PCR products coding for the 99 kd fragment PHKR (bp 2356-5010 of the <italic>dokA</italic> gene), the 51 kd fragment HK (bp 2917-4299) and the 19 kd fragment RR (bp 4528-5010), respectively. The resulting DNA fragments were cloned into the <italic>Eco</italic>RI site of the overexpression vector pDEX-RH [<xref ref-type="bibr" rid="B15">15</xref>] and transformed into <italic>D. discoideum</italic> AX2 cells by electroporation [<xref ref-type="bibr" rid="B26">26</xref>]. The plasmid pDEX-RH bears the G 418 resistance gene that allows the selection of stable transformants. Point mutations in the DokA fragments were introduced into the plasmid before transformation into <italic>Dictyostelium</italic> cells using the QuikChange mutation kit (Stratagene). Selection was carried out with 10 μg G 418/ml and clones were tested for expression by Western blotting and immunostaining with the pAb PHKR antibody. Three independent clones were selected from each transformation.</p>
      </sec>
      <sec>
        <title>Antibodies</title>
        <p>Recombinant DokA fragments purified from <italic>E. coli</italic> M15 (PHKR and HK) were used to raise a polyclonal antibody pAb PHKR in rabbit and the monoclonal antibody mAb 426/HK in mouse. Antibodies were purified using Protein A sepharose (Pharmacia) according to the instructions of the manufacturer and stored at -20°C in phosphate-buffered saline with azide at 0.5 - 1 mg/ml.</p>
      </sec>
      <sec>
        <title>In vivo phosphorylation of DokA fragments</title>
        <p><italic>Dictyostelium</italic> cells which were grown for 16 h in a phosphate-depleted medium were harvested and suspended in 20 mM Mes, pH 6.5 at 1 × 10<sup>7</sup> cells/ml. After 1 h of shaking (150 rpm at 21°C), [<sup>32</sup>P]-orthophosphate was added up to a specific radioactivity of 0.2 - 0.3 mCi/ml. The suspension was shaken for another 60 min and cells were then osmotically shocked by adding a 2 M sorbitol stock solution up to a final concentration of 400 mM. Samples of 1 × 10<sup>7</sup> cells were taken at different points in time before and after the shock. Cells were washed and subsequently frozen with lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 % Triton X-100, 1 % sodium deoxycholate, 0.1 % SDS, 1 mM EDTA, 1 mM DTT, "Complete" protease inhibitor cocktail) in liquid nitrogen. After thawing and centrifugation (14,000 rpm at 4°C), the supernatant was mixed with 3 μg pAb PHKR antibody, incubated 30 min on ice and mixed with Pansorbin cells. After 30 min incubation, the precipitate was centrifuged, washed three times, incubated 3 min at 60°C with Laemmli sample buffer and subjected to SDS-PAGE.</p>
      </sec>
      <sec>
        <title>SDS-PAGE and Western blot analysis</title>
        <p>Polyacrylamide gel electrophoresis was performed according to Laemmli [<xref ref-type="bibr" rid="B27">27</xref>] at 4°C. Proteins on gels were stained with Coomassie Blue or transferred to a PVDF membrane (BioRad) by using a Trans-Blot SD semi-dry transfer system (BioRad). To prove the overexpression or immunoprecipitation of the desired DokA fragment, blots were immunostained with mAb 426/HK or pAb PHKR and an IgG anti-mouse peroxidase-conjugate or IgG anti-rabbit peroxidase-conjugate (Sigma). Stained proteins were visualized by using the Renaissance luminescence detection kit (NEN).</p>
      </sec>
      <sec>
        <title>Phospho-amino acid analysis</title>
        <p>Phospho-amino acid analysis was carried out using two-dimensional thin-layer electrophoresis as described elsewhere [<xref ref-type="bibr" rid="B17">17</xref>].</p>
      </sec>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgments</title>
        <p>We would like to thank Dr. G. Gerisch for help producing the mono-clonal antibodies against HK, A. Ott for help producing the polyclonal sera against PHKR and RR, C. Breithaupt for her help in the course of the experiments and Dr. S. Dammeier for advice on phospho-amino acid analysis. This work was supported by grants (Schu778/3-1, Schu778/3-2) of the Deutsche Forschungsgemeinschaft to S.C.S..</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="B1">
        <citation citation-type="other">
          <person-group person-group-type="author">
            <name>
              <surname>Hoch</surname>
              <given-names>JA</given-names>
            </name>
            <name>
              <surname>Silhavy</surname>
              <given-names>TJ</given-names>
            </name>
          </person-group>
          <article-title>Two-Component Signal Transduction.</article-title>
          <source>Washington, DC: ASM press,</source>
          <year>1995</year>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Loomis</surname>
              <given-names>WF</given-names>
            </name>
            <name>
              <surname>Shaulsky</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>N</given-names>
            </name>
          </person-group>
          <article-title>Histidine kinases in signal transduction pathways of eukaryotes.</article-title>
          <source>J Cell Sci</source>
          <year>1997</year>
          <volume>110</volume>
          <fpage>1141</fpage>
          <lpage>1145</lpage>
          <pub-id pub-id-type="pmid">9191038</pub-id>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Appleby</surname>
              <given-names>JL</given-names>
            </name>
            <name>
              <surname>Parkinson</surname>
              <given-names>JS</given-names>
            </name>
            <name>
              <surname>Bourret</surname>
              <given-names>RB</given-names>
            </name>
          </person-group>
          <article-title>Signal transduction via the multi-step phosphorelay: not necessarily a road less traveled.</article-title>
          <source>Cell</source>
          <year>1996</year>
          <volume>86</volume>
          <fpage>845</fpage>
          <lpage>848</lpage>
          <pub-id pub-id-type="pmid">8808618</pub-id>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Posas</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Wurgler-Murphy</surname>
              <given-names>SM</given-names>
            </name>
            <name>
              <surname>Maeda</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Witten</surname>
              <given-names>EA</given-names>
            </name>
            <name>
              <surname>Thai</surname>
              <given-names>TC</given-names>
            </name>
            <name>
              <surname>Saito</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <article-title>Yeast HOG1 MAP kinase cascade is regulated by a multistep phosphorelay mechanism in the SLN1-YPD1-SSK1 "two-component" osmosensor.</article-title>
          <source>Cell</source>
          <year>1996</year>
          <volume>86</volume>
          <fpage>865</fpage>
          <lpage>875</lpage>
          <pub-id pub-id-type="pmid">8808622</pub-id>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gamble</surname>
              <given-names>RL</given-names>
            </name>
            <name>
              <surname>Coonfield</surname>
              <given-names>ML</given-names>
            </name>
            <name>
              <surname>Schaller</surname>
              <given-names>GE</given-names>
            </name>
          </person-group>
          <article-title>Histidine kinase activity of the ETR1 ethylene receptor from Arabidopsis.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1998</year>
          <volume>95</volume>
          <fpage>7825</fpage>
          <lpage>7829</lpage>
          <pub-id pub-id-type="pmid">9636235</pub-id>
          <pub-id pub-id-type="doi">10.1073/pnas.95.13.7825</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wurgler-Murphy</surname>
              <given-names>SM</given-names>
            </name>
            <name>
              <surname>Saito</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <article-title>Two-component signal transducers and MAPK cascades.</article-title>
          <source>Trends Biochem Sci</source>
          <year>1997</year>
          <volume>22</volume>
          <fpage>172</fpage>
          <lpage>176</lpage>
          <pub-id pub-id-type="pmid">9175476</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0968-0004(97)01036-0</pub-id>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Thomason</surname>
              <given-names>PA</given-names>
            </name>
            <name>
              <surname>Traynor</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Cavet</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Chang</surname>
              <given-names>WT</given-names>
            </name>
            <name>
              <surname>Harwood</surname>
              <given-names>AJ</given-names>
            </name>
            <name>
              <surname>Kay</surname>
              <given-names>RR</given-names>
            </name>
          </person-group>
          <article-title>An intersection of the cAMP/PKA and two-component signal transduction systems in Dictyostelium.</article-title>
          <source>EMBO J</source>
          <year>1998</year>
          <volume>17</volume>
          <fpage>2838</fpage>
          <lpage>2845</lpage>
          <pub-id pub-id-type="pmid">9582277</pub-id>
          <pub-id pub-id-type="doi">10.1093/emboj/17.10.2838</pub-id>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yeh</surname>
              <given-names>KC</given-names>
            </name>
            <name>
              <surname>Lagarias</surname>
              <given-names>JC</given-names>
            </name>
          </person-group>
          <article-title>Eukaryotic phytochromes: Light-regulated serine/threonine protein kinases with histidine kinase ancestry.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1998</year>
          <volume>95</volume>
          <fpage>13976</fpage>
          <lpage>13981</lpage>
          <pub-id pub-id-type="pmid">9811911</pub-id>
          <pub-id pub-id-type="doi">10.1073/pnas.95.23.13976</pub-id>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schuster</surname>
              <given-names>SC</given-names>
            </name>
            <name>
              <surname>Noegel</surname>
              <given-names>AA</given-names>
            </name>
            <name>
              <surname>Oehme</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Gerisch</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Simon</surname>
              <given-names>MI</given-names>
            </name>
          </person-group>
          <article-title>The hybrid histidine kinase DokA is part of the osmotic response system of Dictyostelium.</article-title>
          <source>EMBO J</source>
          <year>1996</year>
          <volume>15</volume>
          <fpage>3880</fpage>
          <lpage>3889</lpage>
          <pub-id pub-id-type="pmid">8670893</pub-id>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wang</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Shaulsky</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Escalante</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Loomis</surname>
              <given-names>WF</given-names>
            </name>
          </person-group>
          <article-title>A two-component histidine kinase gene that functions in Dictyostelium development.</article-title>
          <source>EMBO J</source>
          <year>1996</year>
          <volume>15</volume>
          <fpage>3890</fpage>
          <lpage>3898</lpage>
          <pub-id pub-id-type="pmid">8670894</pub-id>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zinda</surname>
              <given-names>MJ</given-names>
            </name>
            <name>
              <surname>Singleton</surname>
              <given-names>CK</given-names>
            </name>
          </person-group>
          <article-title>The hybrid histidine kinase dhkB regulates spore germination in Dictyostelium discoideum.</article-title>
          <source>Dev Biol</source>
          <year>1998</year>
          <volume>196</volume>
          <fpage>171</fpage>
          <lpage>183</lpage>
          <pub-id pub-id-type="pmid">9576830</pub-id>
          <pub-id pub-id-type="doi">10.1006/dbio.1998.8854</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Singleton</surname>
              <given-names>CK</given-names>
            </name>
            <name>
              <surname>Zinda</surname>
              <given-names>MJ</given-names>
            </name>
            <name>
              <surname>Mykytka</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <article-title>The histidine kinase dhkC regulates the choice between migrating slugs and terminal differentiation in Dictyostelium discoideum.</article-title>
          <source>Dev Biol</source>
          <year>1998</year>
          <volume>203</volume>
          <fpage>345</fpage>
          <lpage>357</lpage>
          <pub-id pub-id-type="pmid">9808785</pub-id>
          <pub-id pub-id-type="doi">10.1006/dbio.1998.9049</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Thomason</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Traynor</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Kay</surname>
              <given-names>RR</given-names>
            </name>
          </person-group>
          <article-title>Taking the plunge-terminal differentiation in Dictyostelium.</article-title>
          <source>Trends Gen</source>
          <year>1999</year>
          <volume>15</volume>
          <fpage>15</fpage>
          <lpage>19</lpage>
          <pub-id pub-id-type="doi">10.1016/S0168-9525(98)01635-7</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Swanson</surname>
              <given-names>RV</given-names>
            </name>
            <name>
              <surname>Schuster</surname>
              <given-names>SC</given-names>
            </name>
            <name>
              <surname>Simon</surname>
              <given-names>MI</given-names>
            </name>
          </person-group>
          <article-title>Expression of CheA fragments which define domains encoding kinase, phosphotransfer and CheY binding activities.</article-title>
          <source>Biochemistry</source>
          <year>1993</year>
          <volume>32</volume>
          <fpage>7623</fpage>
          <lpage>7629</lpage>
          <pub-id pub-id-type="pmid">8347572</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Faix</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Gerisch</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Noegel</surname>
              <given-names>AA</given-names>
            </name>
          </person-group>
          <article-title>Overexpression of the csA adhesion molecule under its own cAMP-regulated promoter impairs morphogenesis in Dictyostelium.</article-title>
          <source>J Cell Sci</source>
          <year>1992</year>
          <volume>102</volume>
          <fpage>203</fpage>
          <lpage>214</lpage>
          <pub-id pub-id-type="pmid">1328260</pub-id>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhulin</surname>
              <given-names>IB</given-names>
            </name>
            <name>
              <surname>Taylor</surname>
              <given-names>BL</given-names>
            </name>
          </person-group>
          <article-title>PAS domain S-boxes in archaea, bacteria and sensors for oxygen and redox.</article-title>
          <source>Trends Biochem Sci</source>
          <year>1997</year>
          <volume>22</volume>
          <fpage>331</fpage>
          <lpage>333</lpage>
          <pub-id pub-id-type="pmid">9301332</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0968-0004(97)01110-9</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Duclos</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Marcandier</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Cozzone</surname>
              <given-names>SJ</given-names>
            </name>
          </person-group>
          <article-title>Chemical properties and separation of phosphoamino acids by thin-layer chromatography and/or electrophoresis.</article-title>
          <source>Methods Enzymol</source>
          <year>1991</year>
          <volume>201</volume>
          <fpage>10</fpage>
          <lpage>21</lpage>
          <pub-id pub-id-type="pmid">1943759</pub-id>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shaulsky</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Fuller</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Loomis</surname>
              <given-names>WF</given-names>
            </name>
          </person-group>
          <article-title>Developmental signal transduction pathways uncovered by genetic suppressors.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1996</year>
          <volume>93</volume>
          <fpage>15260</fpage>
          <lpage>15265</lpage>
          <pub-id pub-id-type="pmid">8986798</pub-id>
          <pub-id pub-id-type="doi">10.1073/pnas.93.26.15260</pub-id>
        </citation>
      </ref>
      <ref id="B19">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yeh</surname>
              <given-names>KC</given-names>
            </name>
            <name>
              <surname>Lagarias</surname>
              <given-names>JC</given-names>
            </name>
          </person-group>
          <article-title>A cyanobacterial phytochrome two-component light sensory system.</article-title>
          <source>Science</source>
          <year>1997</year>
          <volume>277</volume>
          <fpage>1505</fpage>
          <lpage>1508</lpage>
          <pub-id pub-id-type="pmid">9278513</pub-id>
          <pub-id pub-id-type="doi">10.1126/science.277.5331.1505</pub-id>
        </citation>
      </ref>
      <ref id="B20">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Soderbom</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Anjard</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Iranfar</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Fuller</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Loomis</surname>
              <given-names>WF</given-names>
            </name>
          </person-group>
          <article-title>An adenylyl cyclase that functions during late development of Dictyostelium.</article-title>
          <source>Development</source>
          <year>1999</year>
          <volume>126</volume>
          <fpage>5463</fpage>
          <lpage>5471</lpage>
          <pub-id pub-id-type="pmid">10556070</pub-id>
        </citation>
      </ref>
      <ref id="B21">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Galcheva-Gargova</surname>
              <given-names>Z</given-names>
            </name>
            <name>
              <surname>Derijard</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>IH</given-names>
            </name>
            <name>
              <surname>Davis</surname>
              <given-names>RJ</given-names>
            </name>
          </person-group>
          <article-title>An osmosensing signal transduction pathway in mammalian cells.</article-title>
          <source>Science</source>
          <year>1994</year>
          <volume>265</volume>
          <fpage>806</fpage>
          <lpage>808</lpage>
          <pub-id pub-id-type="pmid">8047888</pub-id>
        </citation>
      </ref>
      <ref id="B22">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Han</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>JD</given-names>
            </name>
            <name>
              <surname>Bibbs</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Ulevitch</surname>
              <given-names>RJ</given-names>
            </name>
          </person-group>
          <article-title>A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells.</article-title>
          <source>Science</source>
          <year>1994</year>
          <volume>265</volume>
          <fpage>808</fpage>
          <lpage>811</lpage>
          <pub-id pub-id-type="pmid">7914033</pub-id>
        </citation>
      </ref>
      <ref id="B23">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ott</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Oehme</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Schuster</surname>
              <given-names>SC</given-names>
            </name>
          </person-group>
          <article-title>Osmotic stress response in Dictyostelium is mediated by cAMP.</article-title>
          <source>EMBO J</source>
          <year>2000</year>
          <volume>19</volume>
          <fpage>5782</fpage>
          <lpage>5792</lpage>
          <pub-id pub-id-type="pmid">11060029</pub-id>
          <pub-id pub-id-type="doi">10.1093/emboj/19.21.5782</pub-id>
        </citation>
      </ref>
      <ref id="B24">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yang</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Inouye</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <article-title>Requirement of both kinase and phosphatase activities of an Escherichia coli receptor (Taz1) for ligand-dependent signal transduction.</article-title>
          <source>J Mol Biol</source>
          <year>1993</year>
          <volume>231</volume>
          <fpage>335</fpage>
          <lpage>342</lpage>
          <pub-id pub-id-type="pmid">8389884</pub-id>
          <pub-id pub-id-type="doi">10.1006/jmbi.1993.1286</pub-id>
        </citation>
      </ref>
      <ref id="B25">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Claviez</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Pagh</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Maruta</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Baltes</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Fisher</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Gerisch</surname>
              <given-names>G</given-names>
            </name>
          </person-group>
          <article-title>Electron microscopic mapping of monoclonal antibodies on the tail region of Dictyostelium myosin.</article-title>
          <source>EMBO J</source>
          <year>1982</year>
          <volume>1</volume>
          <fpage>1017</fpage>
          <lpage>1022</lpage>
          <pub-id pub-id-type="pmid">16453425</pub-id>
        </citation>
      </ref>
      <ref id="B26">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Howard</surname>
              <given-names>PK</given-names>
            </name>
            <name>
              <surname>Ahern</surname>
              <given-names>KG</given-names>
            </name>
            <name>
              <surname>Firtel</surname>
              <given-names>RA</given-names>
            </name>
          </person-group>
          <article-title>Establishment of a transient expression system for Dictyostelium discoideum.</article-title>
          <source>Nucleic Acids Res</source>
          <year>1988</year>
          <volume>16</volume>
          <fpage>2613</fpage>
          <lpage>2623</lpage>
          <pub-id pub-id-type="pmid">3362676</pub-id>
        </citation>
      </ref>
      <ref id="B27">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Laemmli</surname>
              <given-names>UK</given-names>
            </name>
          </person-group>
          <article-title>Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</article-title>
          <source>Nature</source>
          <year>1970</year>
          <volume>227</volume>
          <fpage>680</fpage>
          <lpage>685</lpage>
          <pub-id pub-id-type="pmid">5432063</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record><record><header><identifier>oai:pubmedcentral.nih.gov:31331</identifier><datestamp>2001-05-11</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">31331</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-2-3</article-id>
      <article-id pub-id-type="pmid">11286637</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-2-3</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Search for antisense copies of beta-globin mRNA in anemic mouse spleen</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" contrib-type="author">
          <name>
            <surname>Gudima</surname>
            <given-names>Severin O</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>SO_Gudima@FCCC.edu</email>
        </contrib>
        <contrib id="A2" corresp="yes" contrib-type="author">
          <name>
            <surname>Taylor</surname>
            <given-names>John M</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>JM_Taylor@FCCC.edu</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Fox Chase Cancer Center, 7701 Burholme Avenue, Philadelphia, PA 19111-2497</aff>
      <pub-date pub-type="collection">
        <year>2001</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>21</day>
        <month>3</month>
        <year>2001</year>
      </pub-date>
      <volume>2</volume>
      <fpage>3</fpage>
      <lpage>3</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/2/3"/>
      <history>
        <date date-type="received">
          <day>23</day>
          <month>1</month>
          <year>2001</year>
        </date>
        <date date-type="accepted">
          <day>21</day>
          <month>3</month>
          <year>2001</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2001 Gudima and Taylor; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2001</copyright-year>
        <copyright-holder>Gudima and Taylor; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS) globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>Over the years there have been numerous claims for the detection within prokaryotic and eukaryotic cells of antisense RNA sequences (AS). As recently reviewed by Kumar and Carmichael [<xref ref-type="bibr" rid="B1">1</xref>], many of the claims have been substantiated and in a subset of these, biological significance has been established. The origin of most of these AS sequences is transcription via DNA-directed RNA polymerization.</p>
      <p>A much more controversial issue is whether there is AS RNA that arises via RNA-directed RNA polymerization. Of course, for RNA viruses that encode their own polymerase activity, such AS RNA arises as a natural part of the replication cycle for the viral genome. And yet for the subviral RNA agents of plants known as viroids, and for the human (subviral) agent known as hepatitis delta virus (HDV), the replication of the RNA genome involves a host RNA polymerase [<xref ref-type="bibr" rid="B2">2</xref>]. Evidence has accumulated but not established that the relevant polymerase activity is via redirection of a polymerase that normally uses host DNA as a template. For example, it is considered that HDV replication and that of some plant viroids might involve redirection of the host RNA polymerase II [<xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>]. Other plant viroids are considered to replicate via redirection of a chloroplast polymerase activity [<xref ref-type="bibr" rid="B5">5</xref>].</p>
      <p>In contrast to such proposed redirection, studies in plants have found a non-viral host RNA-directed RNA polymerase activity [<xref ref-type="bibr" rid="B6">6</xref>,<xref ref-type="bibr" rid="B7">7</xref>,<xref ref-type="bibr" rid="B8">8</xref>]. After the gene for one of these was cloned and sequenced [<xref ref-type="bibr" rid="B9">9</xref>] it was soon found that homologs existed in virtually all plant species and also in fission yeast, zebrafish, Drosophila, and nematodes [<xref ref-type="bibr" rid="B10">10</xref>]. Recently, this activity has been of particular interest because of exciting findings in the area of post-transcriptional gene silencing and RNA interference. Many papers and reviews have been published recently on these topics and it is clear that the suppression mechanisms involve regions of double-stranded RNA and in some cases, RNA-directed RNA polymerase activity [<xref ref-type="bibr" rid="B11">11</xref>]. Two recent papers show clearly that specific silencing can be induced in mouse oocytes by complementary RNA sequences [<xref ref-type="bibr" rid="B12">12</xref>, <xref ref-type="bibr" rid="B13">13</xref>], but apparently there is no involvement of RNA-directed RNA polymerase activity.</p>
      <p>For the above reasons we were intrigued by the possible relevance of several specific claims for AS RNA and RNA-directed RNA polymerase activity in mammalian cells. In a series of papers by Volloch and coworkers AS RNA was reported for as many as 6 mammalian mRNAs and even RNA-directed RNA polymerase activity was proposed [<xref ref-type="bibr" rid="B14">14</xref>,<xref ref-type="bibr" rid="B15">15</xref>,<xref ref-type="bibr" rid="B16">16</xref>,<xref ref-type="bibr" rid="B17">17</xref>]. These papers focused on mouse β-globin in particular, but they also proposed AS to the mRNAs for serum amyloid A, insulin receptor, eukaryotic transcription factor eIF-4D, vasoactive intestinal polypeptide and syndecan. Most of these data were obtained by a procedure sometimes known as ligation-mediated polymerase chain reaction, that was actually pioneered by the Volloch lab [<xref ref-type="bibr" rid="B18">18</xref>]. However, in two studies the authors also presented Northern data [<xref ref-type="bibr" rid="B14">14</xref>, <xref ref-type="bibr" rid="B15">15</xref>]. They first treated mice with phenylhydrazine (PHZ) to induce high levels of β-globin mRNA in the spleen, and reported that the RNA from the spleen contained low but significant amounts of an AS RNA species with a size of about 600 nucleotides, the size of the mature mRNA [<xref ref-type="bibr" rid="B14">14</xref>]. Also, by ligation-mediated polymerase chain reaction they reported determinations of both 5'- and 3'-ends for this AS RNA [<xref ref-type="bibr" rid="B14">14</xref>]. Volloch <italic>et al.</italic> speculated that the AS species they detected arose via some form of RNA-directed RNA polymerase activity, and further, they suggested that this was a mechanism for the cell to amplify globin mRNA species. Therefore, with these things in mind, we attempted to confirm and extend the most recent study of Volloch <italic>et al.</italic> [<xref ref-type="bibr" rid="B14">14</xref>].</p>
    </sec>
    <sec>
      <title>Results</title>
      <sec>
        <title>Induction of splenomegaly by injections with phenylhydrazine</title>
        <p>Injections of phenylhydrazine (PHZ) into the peritoneum of the mouse were used in previous studies to destroy erythocytes and induced anemia that in turn produced an increase in β-globin mRNA in the spleen. We followed the protocol [<xref ref-type="bibr" rid="B19">19</xref>], as used by Volloch <italic>et al.</italic> It involved 6 daily injections of PHZ into the peritoneal cavity.</p>
        <p>In the study of Volloch <italic>et al.</italic>, they only reported results for samples taken at a single time, day 8. However, since we were interested in the possibility that the status of the animal in this response might be important, we considered animals taken before (i.e., untreated control mice), during, and following the PHZ treatments.</p>
        <p>As shown in Fig. <xref ref-type="fig" rid="F1">1</xref>, the mass of the mouse spleen increased 5-fold even by day 5. This splenomegaly was maintained for at least 3 days after the injections were halted. After 10 days (i.e., 15 days after the PHZ injections were begun) the spleen was reduced in size but was still 2-times bigger than the mass prior to day 0, the time of initiation of the PHZ injections.</p>
        <fig position="float" id="F1">
          <label>Figure 1</label>
          <caption>
            <p>Induction of splenomegaly by treatment of mice with phenylhydrazine. Mice were subjected to i.p. injections of phenyhydrazine (PHZ) solution at the times as indicated by arrows in the figure. Subsequently animals were euthanized and the spleens removed and weighed, as indicated. Each circular symbol represents a single mouse.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-3-1"/>
        </fig>
      </sec>
      <sec>
        <title>Northern analyses to detect 600 nt AS globin RNA</title>
        <p>Clearly, as a consequence of PHZ treatment, the spleen promptly underwent a major increase in mass that was followed by a return to almost normal size. To explore the possibility that some form of antisense RNA with or without PTGS, was involved either during or after treatment, we examined RNA samples taken at a series of times.</p>
        <p>In the earlier studies Volloch <italic>et al.</italic> assayed for β-globin sequences using a 27-nt oligonucleotide that was 5'-end-labelled with <sup>32</sup>P as a probe. We synthesized the same oligonucleotide to detect the mRNA in the RNA extracted from the mouse spleen (Fig. <xref ref-type="fig" rid="F2">2A</xref>, lanes 4-9). Relative to DNA markers, the size of the globin species was around 600 nt, as expected for the globin mRNA [<xref ref-type="bibr" rid="B20">20</xref>]. Note first that even prior to treatment, the spleen RNA presented a strong signal for β-globin mRNA (lane 5). We detected an increase in the amount of this species as a consequence of the PHZ injections. For example, at day 8 after the beginning of the PHZ injections, the amount of β-globin mRNA was increased 6-fold (per microgram of extracted RNA). Thus, after allowance for the 5-fold increase in splenic mass (Fig. <xref ref-type="fig" rid="F1">1</xref>), we deduce that the level of accumulation of β-globin mRNA per spleen was increased about 30-fold as a consequence of the PHZ treatment.</p>
        <fig position="float" id="F2">
          <label>Figure 2</label>
          <caption>
            <p>Northern assays for sense and AS β-globin RNA in RNA extracted from spleens of anemic mice. Duplicate aliquots (30 μg) of RNA extracted from the spleens of animals as described for Fig. <xref ref-type="fig" rid="F1">1</xref>, were glyoxalated and electrophoresed into 2% agarose gels. After electrotransfer, the set of aliquots on one filter were hybridized with a 5'-labeled oligonucleotide to detect the sense strand of β-globin RNA (panel A). A second filter, with the same set of aliquots, was hybridized with a complementary oligonucleotide, to detect AS β-globin RNA (panel B). After quantitation of the radioactivity using a Bio-Imager, the two filters were stripped and rehybridized with radioactive full-length RNA probes to detect either the globin sense (panel C) or AS sequence (panel D). Again after quantitation of the radioactivity, the filter used in panels B and reused in D was stripped once more and rehybridized with an RNA probe to detect both the sense strands of GAPDH and 28 S rRNA (panel E). Lanes 1-3 represent hybridization standards of <italic>in vitro</italic> transcribed globin AS RNA (lane 1), globin sense RNA (lane 2), and double-stranded globin cDNA (lane 3). As expected, these three standards exhibit mobilities somewhat faster than that of mature globin mRNA. In all panels lanes 4-9 represent RNA from spleens of mice at 0, 5, 8, 10, 12, and 15 days, respectively, after the beginning of the PHZ injections. As size standards we used 5'-labelled DNA fragments, with sizes indicated at the left of each panel.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-3-2"/>
        </fig>
        <p>This greatly increased level of β-globin mRNA in the spleen was probably attributable to multiple factors, e.g., increased rates of transcription could be one of the factors, but there is no doubt that the number of reticulocytes in the spleen was increased under these conditions.</p>
        <p>In order to detect AS copies of the RNA we used as a probe, an oligonucleotide that was the exact complement of that used to detect the mRNA. As shown in Fig. <xref ref-type="fig" rid="F2">2B</xref>, this probe failed to detect AS globin RNA in any of the splenic RNA samples. As positive controls for this we used full-size AS RNA as transcribed <italic>in vitro</italic> (lane 1) and also double-stranded globin cDNA (lane 3). As a negative control we used <italic>in vitro</italic> synthesized globin sense RNA (lane 2). After normalization relative to the observed detection sensitivities for the RNA standards, we deduced that in the normal or anemic mouse spleen the amount of the AS strand, if it existed, was &lt;0.004% relative to the amount of sense strand. This inability to detect AS globin RNA was in contrast to the reports of Volloch <italic>et al.</italic> who reported 1-3% in spleen cells [<xref ref-type="bibr" rid="B14">14</xref>]. This contrast was more surprising because we used exactly the same oligonucleotide probes as those reported by Volloch <italic>et al.</italic> The discrepancy may have arisen because of differences in hybridization conditions, such as stringency; unfortunately, we were unable to find the conditions of hybridization used by those authors.</p>
        <p>The strategy of detecting RNA sequences with an oligonucleotide probe would be less sensitive than using a uniformly labeled RNA probe complementary to the entire globin mRNA. We therefore made use of such a probe to detect the mRNA and a corresponding probe for the putative AS RNA. As shown in Fig. <xref ref-type="fig" rid="F2">2C</xref> we obtained clear positive results for the detection of the mRNA (lanes 4-9). However, in contrast to before, we now observed for the spleen samples a band when we used the full-length probe to detect AS RNA (Fig. <xref ref-type="fig" rid="F2">2D</xref>, lanes 4-9).</p>
        <p>For panels A-D the appropriate positive and negative controls for the hybridization are shown in lanes 1-3. Also, as controls for host RNAs in the spleen samples, we hybridized to detect both 1.2 kb GAPDH mRNA [<xref ref-type="bibr" rid="B21">21</xref>] and 4.5 kb 28 S rRNA (Fig. <xref ref-type="fig" rid="F2">2E</xref>). For all six spleen samples (lanes 4-9) the signal of 28 S rRNA per fixed amount of total RNA was essentially constant.</p>
        <p>From an evaluation of these data we consider there are two reasons that lead us to conclude that the "AS signals" detected for the spleen samples in lanes 4-9 of panel D are an artifact. First, the electrophoretic mobility of these bands was indistinguishable from those of the mRNA (Fig. <xref ref-type="fig" rid="F2">2C</xref>). It needs to be pointed out that Volloch <italic>et al.</italic> reported that their AS band was of a greater mobility than the mRNA [<xref ref-type="bibr" rid="B14">14</xref>] although in an earlier study they said the mobilities were indistinguishable [<xref ref-type="bibr" rid="B15">15</xref>]. Second, and of more significance, not only were the signal strengths of putative antisense relative to sense globin the same (about 3%) for each of the 6 spleen samples (lanes 4-9, panels C and D) but the same ratio was obtained for the standards of antisense and sense standards, that were synthesized in vitro. In other words, most, if not all, of the signal that appeared as AS RNA in the splenic samples was explainable as an artifact of hybridization.</p>
        <p>Overall, the two main conclusions from these northern analyses are first, that no AS to globin RNA was detected with oligonucleotide probes and second, that the signal detected with a full-length RNA probe was, at least predominantly, due to an artifact of hybridization.</p>
      </sec>
    </sec>
    <sec>
      <title>Discussion</title>
      <p>As reviewed in the Introduction, it is important to know not only whether post-transcriptional gene silencing occurs in mammalian cells but also whether it can apply under natural conditions, that is, as a regulatory response to enhanced expression of a host RNA species. With this in mind we investigated whether the prior reports of AS to β-globin RNA in anemic mouse spleen could be confirmed and possibly extended. To do this we first established the same procedures in which phenylhydrazine injections were used to induce anemia in mice. We documented the production of a significant and transient splenomegaly (Fig. <xref ref-type="fig" rid="F1">1</xref>). This was associated with a transient 30-fold increase in the amount of β-globin mRNA per unit mass of spleen RNA, followed by a decrease to almost pretreatment levels (Fig. <xref ref-type="fig" rid="F2">2A</xref> and <xref ref-type="fig" rid="F2">2C</xref>).</p>
      <p>From northern analyses and use of specific oligonucleotide probes, each exactly as reported by Volloch <italic>et al.</italic>, we were unable to detect any AS globin RNA sequences (Fig. <xref ref-type="fig" rid="F2">2B</xref>). Furthermore, from the use of appropriate control hybridization standards, and quantitation using a bio-imager, we deduce that relative to the amount of sense RNA as 100%, the putative AS, if it exists, would have to be less than 0.004%. We thus can not understand how Volloch <italic>et al.</italic> reported that spleen cells contained 1-3% amounts of AS globin [<xref ref-type="bibr" rid="B14">14</xref>].</p>
      <p>When we replaced the oligonucleotide probes with more sensitive RNA probes that were uniformly labeled and corresponded to the full-length mRNA (Fig. <xref ref-type="fig" rid="F2">2C-D</xref>), we did detect a species that appeared to be AS globin RNA (Fig. <xref ref-type="fig" rid="F2">2D</xref>). It was suspect that this species had an electrophoretic mobility indistinguishable from that of the detected sense RNA (Fig. <xref ref-type="fig" rid="F2">2C</xref>). However, as described in the results, we can conclude that the signals detected were at least predominantly due to a hybridization artifact. One interpretation of this artifact might be that it arose because of the intramolecular base-pairings in the globin mRNA. This would allow that even radioactive sense sequences might make interactions in a northern analysis with unlabeled sense RNA, even under conditions (hybridization and subsequent washing at 65°C) that we would consider stringent. However, a more likely explanation is that as an artifact of in vitro transcription, the radioactive RNA probes also contain trace amounts of the opposite strand; thus, when used in hybridization in the absence of appropriate specificity controls, one might detect species that would be incorrectly interpretted as AS RNA species.</p>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and methods</title>
      <sec>
        <title>Anemic mice</title>
        <p>Balb/C mice were rendered anemic by 6 daily intraperitoneal injections of phenylhydrazine (Sigma)(PHZ), using the protocol described previously [<xref ref-type="bibr" rid="B19">19</xref>]. Each injection was of 0.1 ml of 0.8% neutralized PHZ in 0.015 M sodium acetate. At days 5, 8, 10, 12, and 15, animals were euthanized and the spleens promptly removed and weighed. Aliquots of 50-100 mg were then incubated at 4°C in a solution of RNAlater (Ambion), after which the liquid was removed and the samples frozen at -80°C.</p>
      </sec>
      <sec>
        <title>RNA extraction</title>
        <p>Frozen samples of spleen tissue were added directly into 10 volumes of Tri-Reagent (Molecular Research Center) followed by immediate processing using a Brinkmann homogenizer. We then followed the manufacturer's instructions to collect the RNA free of DNA and protein.</p>
      </sec>
      <sec>
        <title>Plasmids and RNA transcription</title>
        <p>A plasmid containing the entire 584 nt mouse β-1-globin mRNA sequence, as derived by the Image Consortium (#2779867, AW742238) was obtained from Incyte Genomics (CDNA-1401). To make (radioactive or non-radioactive) globin sense RNA sequences, the plasmid was cut with NotI and transcribed <italic>in vitro</italic> with phage T7 RNA polymerase (Promega). Similarly, to make AS RNAs the construct was digested with EcoRI and copied with phage T3 RNA polymerase (Life Sciences). From this construct we were also able to release the double-stranded cDNA insert, for use as a hybridization standard for normalizing the hybridizations to detect sense and AS strands of globin sequence. In order to detect glyceraldehyde-3-phosphate dehydrogenase (GAPDH) we used a construct with a 1 kb EcoRI cDNA fragment inserted into pBS SK- (Stratagene) to make an RNA probe.</p>
      </sec>
      <sec>
        <title>Northern analyses</title>
        <p>Intact globin RNA species were detected by northern analysis subsequent to glyoxalation and electrophoresis using 2% agarose gels. For Fig. <xref ref-type="fig" rid="F2">2A-B</xref>, strand-specific radioactive DNA probes of the same specific activity were obtained by the 5'-labeling using γ-<sup>32</sup>P [ATP] (7,000 Ci/mM, ICN) of the same two synthetic 27-nt oligomers as used in Volloch <italic>et al.</italic> [<xref ref-type="bibr" rid="B14">14</xref>]. Globin mRNA was detected with 5'-GTGGCCACTCCAGCCACCACCTTCTGG and AS RNA with 5'-CCAGAAGGTGGTGGCTGGAGTGGCCAC. For Fig. <xref ref-type="fig" rid="F2">2C-D</xref> we used full-length <sup>32</sup>P-labeled RNA probes synthesized <italic>in vitro</italic>. Hybridization was carried out at 65°C in Econo™ hybridization buffer (Research Products International). For Fig. <xref ref-type="fig" rid="F2">2E</xref>, the filter was hybridized with an RNA probe specific for mouse GAPDH mRNA.</p>
      </sec>
    </sec>
    <sec>
      <title>Abbreviations</title>
      <p>AS, antisense; PHZ, phenylhydrazine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.</p>
    </sec>
    <sec>
      <title>Commentary</title>
      <p>This paper was accepted for publication dependent on its association with the following commentary from one of the peer reviewers. The commentary can be accessed here:</p>
      <p>
        <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/content/backmatter/1472-2091-2-3-b1.pdf"/>
      </p>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgments</title>
        <p>This work was supported by grants AI-26522 and CA-06927 from the N.I.H., and by an appropriation from the Commonwealth of Pennsylvania. Anthony Lerro and Jackie Valvardi performed the animal experiments. Maureen Murphy provided the GAPDH clone. Finally, constructive comments on the manuscript were provided by Glenn Rall, Richard Katz, Jinhong Chang, and Gloria Moraleda.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="B1">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kumar</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Carmichael</surname>
              <given-names>GG</given-names>
            </name>
          </person-group>
          <article-title>Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes.</article-title>
          <source>Microbiol Mol Biol Rev</source>
          <year>1998</year>
          <volume>62</volume>
          <fpage>1415</fpage>
          <lpage>1434</lpage>
          <pub-id pub-id-type="pmid">9841677</pub-id>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Taylor</surname>
              <given-names>JM</given-names>
            </name>
          </person-group>
          <article-title>Replication of human hepatitis delta virus: influence of studies on subviral plant pathogens.</article-title>
          <source>Adv Vir Res</source>
          <year>1999</year>
          <volume>54</volume>
          <fpage>45</fpage>
          <lpage>60</lpage>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Taylor</surname>
              <given-names>JM</given-names>
            </name>
          </person-group>
          <article-title>Human hepatitis delta virus: structure and replication of the genome.</article-title>
          <source>Curr Top Microbiol Immunol</source>
          <year>1999</year>
          <volume>239</volume>
          <fpage>108</fpage>
          <lpage>122</lpage>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schindler</surname>
              <given-names>I-M</given-names>
            </name>
            <name>
              <surname>Muhlbach</surname>
              <given-names>H-P</given-names>
            </name>
          </person-group>
          <article-title>Involvement of nuclear DNA-dependent RNA polymerases in potato spindle tuber viroid replication: a reevaluation.</article-title>
          <source>Plant Sci</source>
          <year>1992</year>
          <volume>84</volume>
          <fpage>221</fpage>
          <lpage>229</lpage>
          <pub-id pub-id-type="doi">10.1016/0168-9452(92)90138-C</pub-id>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Navarro</surname>
              <given-names>J-A</given-names>
            </name>
            <name>
              <surname>Vera</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Flores</surname>
              <given-names>R</given-names>
            </name>
          </person-group>
          <article-title>A chloroplastic RNA polymerase resistant to targetitoxin is involved in replication of <italic>avocado sunblotch viroid</italic>.</article-title>
          <source>Virology</source>
          <year>2000</year>
          <volume>268</volume>
          <fpage>218</fpage>
          <lpage>225</lpage>
          <pub-id pub-id-type="pmid">10683343</pub-id>
          <pub-id pub-id-type="doi">10.1006/viro.1999.0161</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schiebel</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Haas</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Marinkovik</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Klanner</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Sanger</surname>
              <given-names>HL</given-names>
            </name>
          </person-group>
          <article-title>RNA-directed RNA poylmerase from tomato leaves. I. purification and physical properties.</article-title>
          <source>J Biol Chem</source>
          <year>1993</year>
          <volume>268</volume>
          <fpage>11851</fpage>
          <lpage>11857</lpage>
          <pub-id pub-id-type="pmid">7685022</pub-id>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schiebel</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Haas</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Marinkovic</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Klanner</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Sanger</surname>
              <given-names>HL</given-names>
            </name>
          </person-group>
          <article-title>RNA-directed RNA polymerase from tomato leaves. II. catalytic <italic>in vitro</italic> properties.</article-title>
          <source>J Biol Chem</source>
          <year>1993</year>
          <volume>268</volume>
          <fpage>11858</fpage>
          <lpage>11867</lpage>
          <pub-id pub-id-type="pmid">7685023</pub-id>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Astier-Manifacier</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Cornuet</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <article-title>RNA-dependent RNA polymerase in Chinese cabbage.</article-title>
          <source>Biochem Biophys Acta</source>
          <year>1971</year>
          <volume>232</volume>
          <fpage>484</fpage>
          <lpage>493</lpage>
          <pub-id pub-id-type="pmid">5572618</pub-id>
          <pub-id pub-id-type="doi">10.1016/0005-2787(71)90602-2</pub-id>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schiebel</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Pelissier</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Riedel</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Thalmeir</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Schiebel</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Kempe</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Lottspeich</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Sanger</surname>
              <given-names>HL</given-names>
            </name>
            <name>
              <surname>Wasseneger</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <article-title>Isolation of an RNA-directed RNA polymerase-specific cDNA from tomato.</article-title>
          <source>Plant Cell</source>
          <year>1998</year>
          <volume>10</volume>
          <fpage>2087</fpage>
          <lpage>2101</lpage>
          <pub-id pub-id-type="pmid">9836747</pub-id>
          <pub-id pub-id-type="doi">10.1105/tpc.10.12.2087</pub-id>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cogoni</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Macino</surname>
              <given-names>G</given-names>
            </name>
          </person-group>
          <article-title>Gene silencing in <italic>Neurospora crassa</italic> requires a protein homologous to RNA-dependent RNA polymerase.</article-title>
          <source>Nature</source>
          <year>1999</year>
          <volume>399</volume>
          <fpage>166</fpage>
          <lpage>169</lpage>
          <pub-id pub-id-type="pmid">10335848</pub-id>
          <pub-id pub-id-type="doi">10.1038/20215</pub-id>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sharp</surname>
              <given-names>PA</given-names>
            </name>
          </person-group>
          <article-title>RNAi and double-strand RNA.</article-title>
          <source>Genes Devel</source>
          <year>1999</year>
          <volume>13</volume>
          <fpage>139</fpage>
          <lpage>141</lpage>
          <pub-id pub-id-type="pmid">9925636</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Svoboda</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Stein</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Hayashi</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Schultz</surname>
              <given-names>RM</given-names>
            </name>
          </person-group>
          <article-title>Selective reduction of dormant maternal mRNAs in mouse oocytes by RNA interference.</article-title>
          <source>Development</source>
          <year>2000</year>
          <volume>127</volume>
          <fpage>4147</fpage>
          <lpage>4156</lpage>
          <pub-id pub-id-type="pmid">10976047</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wianny</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Zernick-Goetz</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <article-title>Specific interference with gene function by double-stranded RNA in early mouse development.</article-title>
          <source>Nature Cell Biol</source>
          <year>2000</year>
          <volume>2</volume>
          <fpage>70</fpage>
          <lpage>75</lpage>
          <pub-id pub-id-type="pmid">10655585</pub-id>
          <pub-id pub-id-type="doi">10.1038/35000016</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Volloch</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Schweitzer</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Rits</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Antisense globin RNA in mouse erythroid tissues: structure, origin, and possible function.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1996</year>
          <volume>93</volume>
          <fpage>2476</fpage>
          <lpage>2481</lpage>
          <pub-id pub-id-type="pmid">8637899</pub-id>
          <pub-id pub-id-type="doi">10.1073/pnas.93.6.2476</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Volloch</surname>
              <given-names>V</given-names>
            </name>
          </person-group>
          <article-title>Cytoplasmic synthesis of globin RNA in differentiated murine erythroleukemia cells: possible involvement of RNA-dependent RNA polymerase.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1986</year>
          <volume>83</volume>
          <fpage>1208</fpage>
          <lpage>1212</lpage>
          <pub-id pub-id-type="pmid">3456580</pub-id>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Volloch</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Schweitzer</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Rits</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Inhibition of pre-mRNA splicing by antisense RNA in vitro: effect of RNA containing sequences complementary to exons.</article-title>
          <source>Biochem Biophys Res Commun</source>
          <year>1991</year>
          <volume>179</volume>
          <fpage>1593</fpage>
          <lpage>1599</lpage>
          <pub-id pub-id-type="pmid">1656959</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Volloch</surname>
              <given-names>V</given-names>
            </name>
          </person-group>
          <article-title>A mechanism of beta-amyloid overproduction in Alzheimer's disease: precursor-independent generation of beta-amyloid via antisense RNA-primed mRNA synthesis.</article-title>
          <source>FEBS Lett</source>
          <year>1996</year>
          <volume>390</volume>
          <fpage>124</fpage>
          <lpage>128</lpage>
          <pub-id pub-id-type="pmid">8706841</pub-id>
          <pub-id pub-id-type="doi">10.1016/0014-5793(96)00663-1</pub-id>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Volloch</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Schweitzer</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>X</given-names>
            </name>
            <name>
              <surname>Rits</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Identification of negative-strand complements to cytochrome oxidase subunit III RNA in <italic>Trypanosoma brucei</italic>.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1991</year>
          <volume>88</volume>
          <fpage>10671</fpage>
          <lpage>10675</lpage>
          <pub-id pub-id-type="pmid">1660145</pub-id>
        </citation>
      </ref>
      <ref id="B19">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bastos</surname>
              <given-names>RN</given-names>
            </name>
            <name>
              <surname>Volloch</surname>
              <given-names>Z</given-names>
            </name>
            <name>
              <surname>Aviv</surname>
              <given-names>H</given-names>
            </name>
          </person-group>
          <article-title>Messenger RNA population during erythroid differentiation: a kinetical approach.</article-title>
          <source>J Mol Biol</source>
          <year>1977</year>
          <volume>110</volume>
          <fpage>191</fpage>
          <lpage>203</lpage>
          <pub-id pub-id-type="pmid">845950</pub-id>
        </citation>
      </ref>
      <ref id="B20">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Maniatis</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Kee</surname>
              <given-names>SG</given-names>
            </name>
            <name>
              <surname>Efstratiadis</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Kafatos</surname>
              <given-names>FC</given-names>
            </name>
          </person-group>
          <article-title>Amplification and characterization of a beta-globin gene synthesized <italic>in vitro</italic>.</article-title>
          <source>Cell</source>
          <year>1976</year>
          <volume>8</volume>
          <fpage>163</fpage>
          <lpage>182</lpage>
          <pub-id pub-id-type="pmid">61066</pub-id>
        </citation>
      </ref>
      <ref id="B21">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sabath</surname>
              <given-names>DE</given-names>
            </name>
            <name>
              <surname>Broome</surname>
              <given-names>HE</given-names>
            </name>
            <name>
              <surname>Prystowsky</surname>
              <given-names>MB</given-names>
            </name>
          </person-group>
          <article-title>Glyceraldehyde-3-phosphate dehydrogenase mRNA is a major interleukin 2-induced transcript in a cloned T-helper lymphocyte.</article-title>
          <source>Gene</source>
          <year>1990</year>
          <volume>91</volume>
          <fpage>185</fpage>
          <lpage>191</lpage>
          <pub-id pub-id-type="pmid">2145197</pub-id>
          <pub-id pub-id-type="doi">10.1016/0378-1119(90)90087-8</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record><record><header><identifier>oai:pubmedcentral.nih.gov:31332</identifier><datestamp>2001-05-11</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">31332</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-2-4</article-id>
      <article-id pub-id-type="pmid">11319943</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-2-4</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Upregulation of the SERCA-type Ca<sup>2+</sup> pump activity in response to endoplasmic reticulum stress in PC12 cells</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" contrib-type="author">
          <name>
            <surname>Højmann Larsen</surname>
            <given-names>Annette</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>hojmann@telefona.dk</email>
        </contrib>
        <contrib id="A2" contrib-type="author">
          <name>
            <surname>Frandsen</surname>
            <given-names>Aase</given-names>
          </name>
          <xref ref-type="aff" rid="I2">2</xref>
          <email>aaf@dfh.dk</email>
        </contrib>
        <contrib id="A3" corresp="yes" contrib-type="author">
          <name>
            <surname>Treiman</surname>
            <given-names>Marek</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>M.Treiman@mfi.ku.dk</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Department of Medical Physiology, University of Copenhagen, Denmark</aff>
      <aff id="I2"><label>2</label>Department of Pharmacology, The Royal Danish School of Pharmacy, Denmark</aff>
      <pub-date pub-type="collection">
        <year>2001</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>11</day>
        <month>4</month>
        <year>2001</year>
      </pub-date>
      <volume>2</volume>
      <fpage>4</fpage>
      <lpage>4</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/2/4"/>
      <history>
        <date date-type="received">
          <day>8</day>
          <month>3</month>
          <year>2001</year>
        </date>
        <date date-type="accepted">
          <day>11</day>
          <month>4</month>
          <year>2001</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2001 Højmann Larsen et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2001</copyright-year>
        <copyright-holder>Højmann Larsen et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>Ca<sup>2+</sup>-ATPases of endoplasmic reticulum (SERCAs) are responsible for maintenance of the micro- to millimolar Ca<sup>2+</sup> ion concentrations within the endoplasmic reticulum (ER) of eukaryotic cells. This intralumenal Ca<sup>2+</sup> storage is important for the generation of Ca<sup>2+</sup> signals as well as for the correct folding and posttranslational processing of proteins entering ER after synthesis. ER perturbations such as depletion of Ca<sup>2+</sup> or abolishing the oxidative potential, inhibition of glycosylation, or block of secretory pathway, activate the Unfolded Protein Response, consisting of an upregulation of a number of ER-resident chaperones/stress proteins in an effort to boost the impaired folding capacity.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>We show here that in PC12 cells, depletion of ER Ca<sup>2+</sup> by EGTA, as well as inhibition of disulphide bridge formation within the ER by dithiotreitol or inhibition of N-glycosylation by tunicamycin, led to a 2- to 3-fold increase of the SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> transport to microsomes isolated from cells exposed to these stress agents. The time course of this response corresponded to that for transcriptional upregulation of ER stress proteins, as well as to the increase in the SERCA2b mRNA, as we recently observed in an independent study.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>These findings provide the first functional evidence for the increase of SERCA pumping capacity in cells subjected to the ER stress. Since at least three different and unrelated mechanisms of eliciting the ER stress response were found to cause this functional upregulation of Ca<sup>2+</sup> transport into the ER, these results support the existence of a coupling between the induction of the UPR pathway in general, and the regulation of expression of at least one of the SERCA pump isoforms.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>Endoplasmic reticulum (ER) is a compartment simultaneously involved in the processes of protein synthesis and Ca<sup>2+</sup> homeostasis in eukaryotic cells. Nascent polypeptide chains entering the secretory pathway, as well as extracytosolic portions of proteins destined for the external or internal cell membranes, translocate into the ER lumen. Within the ER, posttranslational processes including folding, glycosylation, subunit assembly and transfer to the Golgi compartment take place, assisted by chaperone proteins residing in the ER lumen [<xref ref-type="bibr" rid="B1">1</xref>,<xref ref-type="bibr" rid="B2">2</xref>]. In addition, proper protein folding and maturation depends on the maintenance of the oxidative milieu and high Ca<sup>2+</sup> concentrations within the ER [<xref ref-type="bibr" rid="B3">3</xref>-<xref ref-type="bibr" rid="B5">5</xref>]. Reducing agents, depletion of ER lumenal Ca<sup>2+</sup>, inhibition of glycosylation or interference with the secretory pathway (by preventing transfer to the Golgi system), each lead to an accumulation of misfolded protein intermediates and increase the demand on the chaperoning capacity. Such conditions, collectively termed ER stress, have been shown to induce ER-specific stress response pathways. Two ER stress pathways concerned with protein processing are recognized today. The Unfolded Protein Response (UPR) was originally described in yeast [<xref ref-type="bibr" rid="B6">6</xref>], and has been more recently demonstrated in mammalian cells [<xref ref-type="bibr" rid="B7">7</xref>]. In mammals, the proximal ER stress-sensing element of this pathway appears to be Ire1p, a 110 kDa, highly conserved protein spanning the ER membrane. It is thought that when misfolded polypeptide chains accumulate within the ER causing a decrease in the level of free chaperones, the lumenal N-terminal portion of Ire1p undergoes dimerization. This in turn leads to a trans-autophosphorylation of the Ire1 cytosolic domains, triggering an ER-to-Nucleus (ERN) signaling [<xref ref-type="bibr" rid="B7">7</xref>]. The details of the ERN signaling are not understood at present. It appears to involve additional activities, in part residing in the cytosolic portion of the Ire1p molecule itself (RNA endonuclease activity), and in part contributed by proteins recruited through binding to Ire1p cytosolic domain (e.g. TRAF2, [<xref ref-type="bibr" rid="B8">8</xref>]). Overall, the major result of the UPR induction is a transcriptional upregulation of a number of stress proteins, including members of the family of Glucose Regulated Proteins (GRPs) such as GRP78 (BiP) and GRP94 (endoplasmin), as well as other chaperones (calreticulin, protein disulfide isomerase, ERp72) [<xref ref-type="bibr" rid="B7">7</xref>], thereby responding to the increased demand for the folding capacity within the ER.</p>
      <p>Another ER-specific stress response has been termed Endoplasmic Reticulum Overload Response (EOR) [<xref ref-type="bibr" rid="B9">9</xref>]), and is triggered by certain of the same conditions known to activate UPR (e.g. glucose deprivation, glycosylation inhibition), as well as by heavy overexpression of proteins within the ER. The distinguishing feature of EOR is its association with the activation of the transcription factor NF-κB [<xref ref-type="bibr" rid="B9">9</xref>].</p>
      <p>While necessary for the folding and maturation processes within the ER, the high concentration of Ca<sup>2+</sup> ions in this compartment (1000-10,1000 times higher than in the cytosol [<xref ref-type="bibr" rid="B10">10</xref>,<xref ref-type="bibr" rid="B11">11</xref>]) is also a prerequisite for the universally employed Ca<sup>2+</sup> signaling through ER Ca<sup>2+</sup> channels (inositol 1,4,5-trisphosphate and ryanodine receptors) [<xref ref-type="bibr" rid="B12">12</xref>,<xref ref-type="bibr" rid="B13">13</xref>]. This high ER Ca<sup>2+</sup> concentration is maintained by ER Ca<sup>2+</sup> pumps, members of the family of Sarco-Endoplasmic Reticulum Calcium ATPases (SERCAs) [<xref ref-type="bibr" rid="B14">14</xref>-<xref ref-type="bibr" rid="B17">17</xref>]. Depletion of ER Ca<sup>2+</sup> has been shown to cause a transcriptional induction of the mRNA for SERCA pumps [<xref ref-type="bibr" rid="B18">18</xref>]. However, the upregulation of an actual SERCA activity in such circumstances has not been demonstrated. In the present work, we provide the first functional evidence that depletion of ER Ca<sup>2+</sup> during cell culture leads to an increase in the SERCA pumping capacity, as expressed by an enhancement of SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake to microsomes isolated from Ca<sup>2+</sup> -depleted PC12 cells. In addition, we show that similar functional SERCA upregulation may also be elicited by conditions of ER stress previously shown not to be accompanied by Ca<sup>2+</sup> depletion. Taken together with our earlier results [<xref ref-type="bibr" rid="B19">19</xref>], the present data support the existence of a linkage between the induction of UPR and the regulation of SERCA gene expression.</p>
    </sec>
    <sec>
      <title>Results and Discussion</title>
      <sec>
        <title>Determination of the SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake into the microsomes from PC12 cells</title>
        <p>The family of SERCA ATPases comprises products of 3 genes, giving rise to a number of enzyme isoforms after differential splicing of primary RNA transcripts [<xref ref-type="bibr" rid="B16">16</xref>,<xref ref-type="bibr" rid="B17">17</xref>]. SERCA1a-1b enzymes are expressed exclusively in skeletal muscle fast-twitch fibers, SERCA2a occurs in slow-twitch fibers of skeletal muscle as well as in cardiac muscle, while SERCA2b is expressed ubiquitously. SERCA3 gene products comprise isoforms 3a, 3b and 3c in mouse and human [<xref ref-type="bibr" rid="B20">20</xref>] and 3a and 3 b/c in rat [<xref ref-type="bibr" rid="B15">15</xref>]. SERCA3 Ca<sup>2+</sup> -ATPase appears to have a restricted tissue distribution, with the highest levels found in the intestine, lung, lymphatic and hematopoietic tissues. Both SERCA2b and SERCA3 isoforms have been identified in PC12 cells [<xref ref-type="bibr" rid="B21">21</xref>].</p>
        <p>The sesquiterpene lactone thapsigargin has been found to have a uniformly high inhibitory potency towards all SERCA subtypes, while showing no activity against the plasma membrane (PMCA-type) Ca<sup>2+</sup> pump at the comparable concentrations [<xref ref-type="bibr" rid="B22">22</xref>,<xref ref-type="bibr" rid="B23">23</xref>]. We therefore defined the SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake to PC12 cell microsomes as that portion of the total ATP-dependent <sup>45</sup>Ca<sup>2+</sup> accumulation which could be inhibited by 1 μM thapsigargin. In order to optimize the accuracy of the assay, we were seeking conditions under which this thapsigargin-sensitive fraction would be as large as possible. ER is known to be permeable to the oxalate anion, commonly employed in studies of <sup>45</sup>Ca<sup>2+</sup> uptake into the ER in order to increase the <sup>45</sup>Ca<sup>2+</sup> sequestering capacity of the vesicles and to prolong the linear course of <sup>45</sup>Ca<sup>2+</sup> accumulation [<xref ref-type="bibr" rid="B24">24</xref>,<xref ref-type="bibr" rid="B25">25</xref>]. However, the reported concentrations of oxalate appear to vary considerably. We therefore tested how a choice of a particular oxalate concentration would influence the size of the thapsigargin-sensitive fraction of <sup>45</sup>Ca<sup>2+</sup> uptake in our system. Fig. <xref ref-type="fig" rid="F1">1A</xref> shows that in the absence of thapsigargin, a strong linear correlation (P = 0.0002) existed between the amount of oxalate (up to 24 mM) in the assay and the amount of <sup>45</sup>Ca<sup>2+</sup> loaded to the microsomes. In contrast, in the presence of 1 μM thapsigargin, the regression line did not significantly differ from horizontal (P = 0.1696), showing that oxalate had a minimal, if any, augmenting effect on <sup>45</sup>Ca<sup>2+</sup> uptake to the thapsigargin-insensitive (SERCA-independent) microsomal compartments. These results suggested that the most advantageous conditions for measurements of the thapsigargin-sensitive component were present at the highest oxalate concentrations. However, we also observed an increasing non-linearity of the time dependence (steepening of the slope between 5-25 minutes) of <sup>45</sup>Ca<sup>2+</sup> uptake at high oxalate concentrations (not shown). Therefore, as a compromise 18 mM oxalate was chosen for the remaining experiments. (A minor non-linearity was still observed at this concentration, Fig. <xref ref-type="fig" rid="F1">1B</xref>, open circles). With 18 mM oxalate, the thapsigargin-sensitive component of <sup>45</sup>Ca<sup>2+</sup> uptake varied between 40-66% of the total uptake in non-stressed (control) cells (compare Figs. <xref ref-type="fig" rid="F1">1A</xref> and <xref ref-type="fig" rid="F1">1B</xref>).</p>
        <fig position="float" id="F1">
          <label>Figure 1</label>
          <caption>
            <p><italic>SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake into microsomes isolated from PC12 cells: oxalate dep endence and effect of endoplasmic reticulum <sup>45</sup>Ca<sup>2+</sup>-store depletion by EGTA.</italic> In A, numbers of independent experiments (n) were 5,2,3,6 and 5 for oxalate concentrations 0, 6,12,18 and 24 mM, respectively. In B, n = 3 for all data points. Bars represent SEMs. Lines were fitted by linear regression. A. Oxalate selectively enhances <sup>45</sup>Ca<sup>2+</sup> uptake to the thapsigargin-sensitive (SERCA-mediated) portion of the total microsomal uptake. Microsomes were prepared from PC12 cells, and <sup>45</sup>Ca<sup>2+</sup> uptake was determined as described in Materials and Methods section, with 25 min incubation time and various concentrations of oxalate either in the absence (●) or presence (○) of 1 μM thapsigargin. B. Depletion of Ca<sup>2+</sup> stores by exposure of cells to EGTA affects specifically the thapsigargin-sensitive (SERCA-mediated) component of microsomal <sup>45</sup>Ca<sup>2+</sup> uptake. Microsomes were prepared from cells cultured under control conditions (□,■) or in the presence of 2.5 mM EGTA for 7 h before harvesting (○,●). <sup>45</sup>Ca<sup>2+</sup> uptake was determined as a function of time in the presence of 18 mM oxalate either in the absence (○,□) or presence (●,■) of 1 μM thapsigargin.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-4-1"/>
        </fig>
        <p>The linearity of <sup>45</sup>Ca<sup>2+</sup> uptake with time argues against the <sup>45</sup>Ca<sup>2+</sup> accumulation in the vesicles being influenced by membrane leak. Since the rate of a passive leak would be increasing with the amount of <sup>45</sup>Ca<sup>2+</sup> accumulated, the slope of the uptake would be expected to decline with time. In contrast, the slope of the uptake time-dependence was essentially constant (or slightly increasing) even at the <italic>highest</italic> recorded rates (EGTA treatment of cells, Fig. <xref ref-type="fig" rid="F1">1B</xref>), indicating that the measurements closely approximated the initial velocity of SERCA pump, even with the absolute uptake rates well below V<sub>max</sub> due to the free <sup>45</sup>Ca<sup>2+</sup> held at 0.22-μM and the absence of DTT in the assay (see below). In addition, the following consideration argues strongly for the amounts of <sup>45</sup>Ca<sup>2+</sup> retained in the vesicles reflecting almost exclusively the formation of the insoluble precipitate, with no possibility of passive leak: given the solubility product of Ca<sup>2+</sup>-oxalate of approximately 2 × 10<sup>-9</sup> M [<xref ref-type="bibr" rid="B24">24</xref>], already at 10 mM lumenal oxalate one would reach a maximal concentration of free <sup>45</sup>Ca<sup>2+</sup> in the lumen equal to the employed extravesicular free <sup>45</sup>Ca<sup>2+</sup> (0.2 μM), with no <sup>45</sup>Ca<sup>2+</sup> gradient available for a leak pathway. Since 18 mM oxalate was used, it appears highly unlikely that a leak gradient could be established, even allowing for an incomplete oxalate equilibration between the vesicles and the medium.</p>
      </sec>
      <sec>
        <title>Increase of the SERCA-mediated <sup>45</sup>Ca<sup>2+</sup>-uptake into the microsomes from PC12 cells subjected to depletion of ER Ca<sup>2+</sup></title>
        <p>In a number of systems, the ER stress response has been induced by manipulations depleting Ca<sup>2+</sup> from the ER. Means of inducing this response have included Ca<sup>2+</sup> ionophores [<xref ref-type="bibr" rid="B26">26</xref>-<xref ref-type="bibr" rid="B28">28</xref>] and Ca<sup>2+</sup> chelating agents applied inside the cells (e.g. BAPTA, [<xref ref-type="bibr" rid="B29">29</xref>]). Alternatively, application of EGTA in the external medium has been shown to deplete ER Ca<sup>2+</sup> in a number of cell types [<xref ref-type="bibr" rid="B30">30</xref>], including PC12 cells [<xref ref-type="bibr" rid="B31">31</xref>]. In order to test the effect of Ca<sup>2+</sup>depletion on the SERCA activity, we cultured PC12 cells for 7 hours in the presence of 2.5 mM EGTA, representing an excess of 0.7 mM over the total Ca<sup>2+</sup> concentration in the DMEM medium. Such EGTA exposure would be expected to induce the UPR, but not the EOR [<xref ref-type="bibr" rid="B9">9</xref>] response. Recently we have confirmed this UPR-inducing effect of EGTA in PC12 cells by demonstrating an increase in GRP78 (BiP) mRNA [<xref ref-type="bibr" rid="B19">19</xref>]. Fig. <xref ref-type="fig" rid="F1">1B</xref> shows the time dependence of <sup>45</sup>Ca<sup>2+</sup> uptake measured in the presence or absence of 1 μM thapsigargin in microsomes prepared from the control cells and cells stressed by the presence of EGTA. A clear increase in the ATP-dependent <sup>45</sup>Ca<sup>2+</sup> uptake was found following the EGTA treatment. Importantly, Fig. <xref ref-type="fig" rid="F1">1B</xref> shows that this increase was due specifically to the thapsigargin-sensitive component of <sup>45</sup>Ca<sup>2+</sup> uptake: an identical activity was measured in the presence of thapsigargin in the microsomes from the stressed (filled circles) and non-stressed (filled squares) cells. (This unchanged activity in the presence of thapsigargin also indicated that the stress treatment of cells did not affect the membrane recovery or <sup>45</sup>Ca<sup>2+</sup> uptake in some gross, non-specific manner). Therefore, this upregulation of <sup>45</sup>Ca<sup>2+</sup> uptake was due to an increase in the SERCA activity in membrane vesicles derived from the ER.</p>
      </sec>
      <sec>
        <title>Increase of the SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake following ER stress without Ca<sup>2+</sup> depletion</title>
        <p>The observed upregulation of the SERCA activity might be specifically due to Ca<sup>2+</sup> depletion from the ER, or it might be linked to the activation of the UPR pathway, irrespective of the particular means of inducing ER stress. Tunicamycin is an inducer of UPR due to its inhibitory action on N-linked glycosylation [<xref ref-type="bibr" rid="B32">32</xref>]. Brefeldin A is a fungal toxin causing a collapse of the Golgi compartment through its absorption into the ER [<xref ref-type="bibr" rid="B33">33</xref>], and inducing the UPR in response to an overload of transport-arrested proteins in the ER lumen. The ER stress-inducing action of DTT is due to its perturbing of the ER lumen oxidative environment, thereby interfering with the protein disulfide bridge formation [<xref ref-type="bibr" rid="B5">5</xref>]. We have previously confirmed that tunicamycin, brefeldin A or DTT, while inducing the ER stress response, did not appear to deplete the ER Ca<sup>2+</sup> in PC12 cells [<xref ref-type="bibr" rid="B19">19</xref>]. Fig. <xref ref-type="fig" rid="F2">2</xref> shows the effects of the exposure of PC12 cells to brefeldin A, tunicamycin or DTT on the thapsigargin-sensitive component of <sup>45</sup>Ca<sup>2+</sup> uptake to the isolated microsomes. (For comparison, the effect of EGTA from Fig. <xref ref-type="fig" rid="F1">1B</xref> is also included). In Fig. <xref ref-type="fig" rid="F2">2</xref>, only the thapsigargin-sensitive <sup>45</sup>Ca<sup>2+</sup> uptake component is shown, as none of the indicated treatments affected the magnitude of <sup>45</sup>Ca<sup>2+</sup> uptake in the presence of 1 μM thapsigargin. It may be seen that while the increase in the SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake after EGTA exposure reached 326% (P &lt; 0.01) of the value in non-stressed cells, increases were also observed with tunicamycin (341% of the control, P &lt; 0.01) and DTT (227%, P &lt; 0.02). Brefeldin A caused an increase to 150% of the level in the unstressed cells (not significant statistically).</p>
        <fig position="float" id="F2">
          <label>Figure 2</label>
          <caption>
            <p><italic>Upregulation of SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake into microsomes prepared after exposure of PC12 cells to various types of ER stress.</italic> EGTA (2.5 mM), brefeldin A (BFA) 5 μg/ml, tunicamycin (Tun) 10 g/ml, or DTT 1 mM were present in the culture medium for the indicated times prior to cell harvest (in "4h+3" condition, after 4 h in the presence of DTT, control medium was reintroduced for 3 h prior to cell harvest). The microsomes were prepared and <sup>45</sup>Ca<sup>2+</sup> uptake determined as described in Materials and Methods. For all conditions, the thapsigargin-sensitive portion of the uptake (see Figs. <xref ref-type="fig" rid="F1">1A,B</xref>) was calculated and expressed as % of the corresponding thapsigargin-sensitive portion for untreated cells, as determined in parallel for each separate condition. (None of the treatments affected the thapsigargin-insensitive portion of <sup>45</sup>Ca<sup>2+</sup> uptake). For each condition, statistical significance of the difference between these pairs of values was determined using 2-tailed student's t-test, with P values and numbers of independent experiments (n) as indicated. Bars represent SEMs.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-4-2"/>
        </fig>
        <p>When microsomes prepared from non-stressed cells were assayed for <sup>45</sup>Ca<sup>2+</sup> uptake in the presence of 1 mM DTT, an increase (524%, P &lt; 0.01) in the SERCA-mediated uptake component was observed (not shown). This result suggested that an oxidation of ATPase on critical cysteine residues, with a consequent loss of activity, had occurred in the course of microsome preparation. Indeed, some studies have routinely included DTT in SERCA isolation buffers to prevent such loss of activity [<xref ref-type="bibr" rid="B34">34</xref>,<xref ref-type="bibr" rid="B35">35</xref>]. We therefore tested whether the observed increase of microsomal <sup>45</sup>Ca<sup>2+</sup> uptake following the exposure of PC12 cells to DTT for 7 hours did reflect an upregulation of Ca<sup>2+</sup>-pumping capacity in the intact cells, rather than representing an enzyme protection effect due to a carry-over of some DTT in the course of cell harvest and microsome preparation. However, the following results appear to rule out such an assay-related mode of action for DTT. First, an increase to 197% of the control (P &lt; 0.04) (not significantly different from the 227% seen with 7 hours of DTT exposure) was obtained when DTT was added to the culture medium for a period of 4 hours, followed by a change to DTT-free medium for the remaining 3 hours prior to cell harvest (Fig. <xref ref-type="fig" rid="F2">2</xref>, "4h+3"). This result is consistent with the DTT-mediated induction of SERCA mRNA increase in the treated cells within the first 4 hours, similar to the known time course of the induction of mRNA for some of the ER stress proteins [<xref ref-type="bibr" rid="B19">19</xref>],[<xref ref-type="bibr" rid="B26">26</xref>-<xref ref-type="bibr" rid="B29">29</xref>]. Translation of SERCA protein from this increased amount of mRNA during the last 3 hours would not be expected to depend on the continuing presence of DTT. Secondly, in a reverse test, DTT was added to the medium for only 25 minutes (i.e. for the duration equal to the incubation time in the microsomal <sup>45</sup>Ca<sup>2+</sup> uptake assay) immediately before cell harvest. No change in the SERCA-mediated <sup>45</sup>Ca<sup>2+</sup> uptake to the microsomes was observed under these conditions (Fig. <xref ref-type="fig" rid="F2">2</xref>, "25min"). Thus, a mere 25 minutes exposure to 1mM DTT, while strongly enhancing SERCA activity at the stage of the <sup>45</sup>Ca<sup>2+</sup>microsomal uptake assay, was not effective at the level of whole cells. Hence, the mechanisms by which DTT was able to enhance the SERCA-mediated microsomal <sup>45</sup>Ca<sup>2+</sup> accumulation were clearly different in these 2 modes of DTT action: the cell-dependent mode, observed after a prolonged (hours) presence of DTT in the cell culture, but not requiring DTT for the last 3 hours before cell harvesting, microsome preparation and assay; and the cell-independent mode, in which a relatively short (25 min) presence of DTT in the assay, but not during the cell culture, was sufficient.</p>
      </sec>
    </sec>
    <sec>
      <title>Conclusions</title>
      <p>This work shows for the first time an upregulation of ER Ca<sup>2+</sup> -ATPase (SERCA) activity upon a disturbance of the internal ER environment by several agents known to evoke the ER stress response, or UPR. Since UPR may be activated by a variety of unrelated stimuli, e.g. Ca<sup>2+</sup> depletion, inhibition of glycosylation, misfolding due to faulty amino acid precursors, energy deprivation or interference with the ER oxidative milieu [<xref ref-type="bibr" rid="B7">7</xref>,<xref ref-type="bibr" rid="B9">9</xref>], it may be thought of as a "final common pathway" for signaling ER stress caused by a range of factors. Therefore, we suggest that the UPR pathway is a likely candidate for the common mechanism to underlie the upregulation of SERCA activity following treatments with agents as different in their modes of action as EGTA, tunicamycin and DTT. Within this proposed common mechanism for SERCA activation due to UPR, some variation in the response amplitude between the individual agents appears to exist (Fig. <xref ref-type="fig" rid="F2">2</xref>). Further work will be required to understand the level (transcriptional and/or translational), and the exact mechanisms of such differences.</p>
      <p>We have recently reported that treatment of PC12 cells with EGTA, tunicamycin, DTT or brefeldin A induced approximately 3- to 4-fold increases in the mRNA for SERCA2b, and approximately 2-fold increases in SERCA2b immunoreactive protein, with no corresponding changes for SERCA3 [<xref ref-type="bibr" rid="B19">19</xref>]. An upregulation of SERCA activity was also supported in this earlier work by an increase in the amount of SERCA phosphoenzyme. However, we would like to stress that despite these indications, the actual demonstration by the present paper of the stress-induced increase in the capacity of <italic>Ca</italic><sup>2+</sup><italic>transport</italic> into the ER was important for at least 2 reasons. First, as previously discussed [<xref ref-type="bibr" rid="B19">19</xref>, p.22371], technical difficulties precluded an accurate comparison of the extent of ATPase upregulation as measured at the immunoprotein and the phosphoenzyme level. Second, we were concerned with the possibility that ER stress, even if causing an increased synthesis of the immunoreactive protein, might at the same time by its very nature result in a faulty posttranslational processing of SERCA2b, with a degree of functional impairment. Since, as shown by the mutagenesis work [<xref ref-type="bibr" rid="B36">36</xref>], it is possible to disrupt the Ca<sup>2+</sup> transport cycle of Ca<sup>2+</sup> -ATPase without affecting at least some of the partial phosphorylation reactions, an actual full measurement in the present paper of the thapsigargin-sensitive Ca<sup>2+</sup> transport into the ER was necessary to unequivocally demonstrate the validity of the ER stress-induced upregulation of SERCA2b activity.</p>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and Methods</title>
      <p>PC12 cells were kindly provided by Drs. M. Grønborg and S. Gammeltoft, Glostrup County Hospital, Denmark. Dulbecco's modified Eagle's medium (DMEM;GlutaMAX-type), horse serum and fetal bovine serum were from GibcoBRL Life Technologies. <sup>45</sup>CaCl<sub>2</sub> (specific activity 0.2-2 Ci/mmole Ca<sup>2+</sup>) was from Pharmacia Amersham DK. Thapsigargin was a generous gift from Dr. S.B. Christensen, The Royal Danish School of Pharmacy.</p>
      <sec>
        <title>Cell culture and stress treatments</title>
        <p>Non-differentiated PC12 cells were grown in 88% DMEM containing HEPES 25 mM, glucose 4.5 mg/ml, penicillin 17.5 U/ml, streptomycin 17.5 μg/ml, and supplemented with horse serum 6%, fetal bovine serum 6% . Cells were grown at 37°C in the presence of 5% CO<sub>2</sub> -atmosphere, and were passaged weekly. Before various experimental treatments, cells were plated onto rat tail collagen-coated culture dishes (100 mm diameter, 3.5 μg collagen/cm<sup>2</sup>) [<xref ref-type="bibr" rid="B37">37</xref>]. To elicit the stress response, agents (ethyleneglycolbis(β-aminomethyl ether)-N,N' -tetraacetic acid (EGTA) 2.5 mM, dithiotreitol (DTT) 1 mM, tunicamycin 10 g/ml or brefeldin A 5 μg/ml) were included in the medium for 7 hours prior to cell harvest. These agents were added to the culture medium as stock solutions in water concentrated 100-fold (EGTA) or 1000-fold (DTT), or as a 1000-fold concentrated solution in dimethyl sulfoxide (DMSO) (tunicamycin, brefeldin A). To neutralize the acidification of the medium upon addition of EGTA, the EGTA stock was adjusted to pH 9.16. Corresponding solvent volumes were added to the dishes with control cells for each of the treatments. Following the removal of the medium, the cells were harvested in cold phosphate-buffered saline . The cells were centrifuged and resuspended in the homogenization buffer (HB) consisting of sucrose 300 mM, N-tris(hydroxymethyl)methyl-2-aminomethanesulfonic acid (TES) 20 mM, pH 7.0, containing phenylmethyl sulfonyl fluoride (PMSF) 0.5 mM. Cell viability was monitored by Trypan Blue staining and was better than 90% in control and stress-agent treated cell batches.</p>
      </sec>
      <sec>
        <title>Preparation of microsomes</title>
        <p>Cells were broken on ice using the cell cracker from the European Molecular Biology Laboratory workshop [<xref ref-type="bibr" rid="B38">38</xref>], employing the clearance of 12 μm and 10 passages. The homogenates were centrifuged for 10 min at 1000 g, followed by a centrifugation of consecutive supernatants first for 10 min at 10,000 g, and then for 1 h at 100,000 g. The microsomal pellets were resuspended in HB and stored at -20°C. Approximately 30 μg of microsomal protein was obtained for each million cells fractionated.</p>
      </sec>
      <sec>
        <title><sup>45</sup>Ca<sup>2+</sup> uptake</title>
        <p>This was determined using 20-50 μg microsomal protein/ml in 1 ml final incubation volume by means of a filtration assay, as described earlier [<xref ref-type="bibr" rid="B39">39</xref>]. Briefly, the incubation medium (at 37°C) contained (in mM): TES 20 (pH 7.0), sucrose 60, KCl 114, MgCl<sub>2</sub> 5, EGTA 1 mM, <sup>45</sup>CaCl<sub>2</sub> (approximately 5.7 mCi/mmole) 0.35 mM (yielding free Ca<sup>2+</sup> 0.22 μM [<xref ref-type="bibr" rid="B40">40</xref>], and various K<sup>+</sup> -oxalate concentrations, as indicated for the individual experiments. Parallel determinations were run in the presence and absence of thapsigargin 1 μM, with an equivalent volume of DMSO solvent (1%) present in all incubations. The uptake was started by addition of ATP to the final 2.5 mM, and was terminated after 25 min, except when otherwise indicated. All determinations were carried out in triplicate.</p>
      </sec>
      <sec>
        <title>Other methods</title>
        <p>Protein was determined using fluorescamine assay [<xref ref-type="bibr" rid="B41">41</xref>]. Statistical significance of the results was estimated using student's two-tailed t-test.</p>
      </sec>
    </sec>
    <sec>
      <title>Abbreviations</title>
      <p>Ca<sup>2+</sup>-ATPase, Ca<sup>2+</sup>-dependent adenosine triphosphatase; DMSO, dimethyl sulfoxide; DTT, dithiotreitol; EGTA, ethyleneglycolbis(β-aminomethyl ether)-N,N'-tetraacetic acid; EOR, endoplasmic reticulum overload response; ER, endoplasmic reticulum; ERN signaling, ER-to-nucleus signaling; GRP, glucose-regulated protein; SERCA, sarco-endoplasmic reticulum calcium ATPase; UPR, unfolded protein response</p>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgements</title>
        <p>This work was supported by the Danish Government Biotechnology Program, the Novo-Nordisk Foundation and the State Health Research Council (SHRC). AHL held a SHRC student scholarship. We are grateful to Ms. N. Buch Petersen for her excellent technical assistance during the completion stage of this work.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="B1">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gething</surname>
              <given-names>M-J</given-names>
            </name>
            <name>
              <surname>Sambrook</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title>Protein folding in the cell.</article-title>
          <source>Nature</source>
          <year>1992</year>
          <volume>355</volume>
          <fpage>33</fpage>
          <lpage>45</lpage>
          <pub-id pub-id-type="pmid">1731198</pub-id>
          <pub-id pub-id-type="doi">10.1038/355033a0</pub-id>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hammond</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Helenius</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title>Quality control in the secretory pathway.</article-title>
          <source>Curr Opin Cell Biol</source>
          <year>1995</year>
          <volume>7</volume>
          <fpage>523</fpage>
          <lpage>529</lpage>
          <pub-id pub-id-type="pmid">7495572</pub-id>
          <pub-id pub-id-type="doi">10.1016/0955-0674(95)80009-3</pub-id>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cooper</surname>
              <given-names>GR</given-names>
            </name>
            <name>
              <surname>Brostrom</surname>
              <given-names>CO</given-names>
            </name>
            <name>
              <surname>Brostrom</surname>
              <given-names>MA</given-names>
            </name>
          </person-group>
          <article-title>Analysis of the endoplasmic reticular Ca<sup>2+</sup> requirement for alpha1-antitrypsin processing and transport competence.</article-title>
          <source>Biochem J</source>
          <year>1997</year>
          <volume>325</volume>
          <fpage>601</fpage>
          <lpage>608</lpage>
          <pub-id pub-id-type="pmid">9271078</pub-id>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lodish</surname>
              <given-names>HF</given-names>
            </name>
            <name>
              <surname>Kong</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Wikstrom</surname>
              <given-names>L</given-names>
            </name>
          </person-group>
          <article-title>Calcium is required for folding of newly made subunits of the asialoglycoprotein receptor within the endoplasmic reticulum.</article-title>
          <source>J Biol Chem</source>
          <year>1992</year>
          <volume>267</volume>
          <fpage>12753</fpage>
          <lpage>12760</lpage>
          <pub-id pub-id-type="pmid">1618778</pub-id>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Braakman</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Helenius</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Helenius</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title>Manipulating disulfide bond formation and protein folding in the endoplasmic reticulum.</article-title>
          <source>EMBO J</source>
          <year>1992</year>
          <volume>11</volume>
          <fpage>1717</fpage>
          <lpage>1722</lpage>
          <pub-id pub-id-type="pmid">1582407</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kozutsumi</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Segal</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Normington</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Gething</surname>
              <given-names>M-J</given-names>
            </name>
            <name>
              <surname>Sambrook</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title> The presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose- regulated proteins.</article-title>
          <source>Nature</source>
          <year>1988</year>
          <volume>332</volume>
          <fpage>462</fpage>
          <lpage>464</lpage>
          <pub-id pub-id-type="pmid">3352747</pub-id>
          <pub-id pub-id-type="doi">10.1038/332462a0</pub-id>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kaufman</surname>
              <given-names>RJ</given-names>
            </name>
          </person-group>
          <article-title>Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls.</article-title>
          <source>Genes and Dev</source>
          <year>1999</year>
          <volume>13</volume>
          <fpage>1211</fpage>
          <lpage>1233</lpage>
          <pub-id pub-id-type="pmid">10346810</pub-id>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Urano</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>X</given-names>
            </name>
            <name>
              <surname>Bertolotti</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Y</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1.</article-title>
          <source>Science</source>
          <year>2000</year>
          <volume>287</volume>
          <fpage>664</fpage>
          <lpage>666</lpage>
          <pub-id pub-id-type="pmid">10650002</pub-id>
          <pub-id pub-id-type="doi">10.1126/science.287.5453.664</pub-id>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Pahl</surname>
              <given-names>HL</given-names>
            </name>
          </person-group>
          <article-title>Signal transduction from the endoplasmic reticulum to the cell nucleus.</article-title>
          <source>Physiol Rev</source>
          <year>1999</year>
          <volume>79</volume>
          <fpage>683</fpage>
          <lpage>701</lpage>
          <pub-id pub-id-type="pmid">10390516</pub-id>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bygrave</surname>
              <given-names>FL</given-names>
            </name>
            <name>
              <surname>Benedetti</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title>What is the concentration of calcium ions in the endoplasmic reticulum?</article-title>
          <source>Cell Calcium</source>
          <year>1996</year>
          <volume>19</volume>
          <fpage>547</fpage>
          <lpage>551</lpage>
          <pub-id pub-id-type="pmid">8842522</pub-id>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Meldolesi</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Pozzan</surname>
              <given-names>T</given-names>
            </name>
          </person-group>
          <article-title>The endoplasmic reticulum Ca<sup>2+</sup> store: a view from the lumen.</article-title>
          <source>Trends Biochem Sci</source>
          <year>1998</year>
          <volume>23</volume>
          <fpage>10</fpage>
          <lpage>14</lpage>
          <pub-id pub-id-type="pmid">9478128</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0968-0004(97)01143-2</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Patel</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Joseph</surname>
              <given-names>SK</given-names>
            </name>
            <name>
              <surname>Thomas</surname>
              <given-names>AP</given-names>
            </name>
          </person-group>
          <article-title>Molecular properties of inositol 1,4,5-trisphosphate receptors.</article-title>
          <source>Cell Calcium</source>
          <year>1999</year>
          <volume>25</volume>
          <fpage>247</fpage>
          <lpage>264</lpage>
          <pub-id pub-id-type="pmid">10378086</pub-id>
          <pub-id pub-id-type="doi">10.1054/ceca.1999.0021</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mackrill</surname>
              <given-names>JJ</given-names>
            </name>
          </person-group>
          <article-title>Protein-protein interactions in intracellular Ca<sup>2+</sup> release channel function.</article-title>
          <source>Biochem J</source>
          <year>1999</year>
          <volume>337</volume>
          <fpage>345</fpage>
          <lpage>361</lpage>
          <pub-id pub-id-type="pmid">9895277</pub-id>
          <pub-id pub-id-type="doi">10.1042/0264-6021:3370345</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Burk</surname>
              <given-names>SE</given-names>
            </name>
            <name>
              <surname>Lytton</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>MacLennan</surname>
              <given-names>DH</given-names>
            </name>
            <name>
              <surname>Shull</surname>
              <given-names>GE</given-names>
            </name>
          </person-group>
          <article-title>cDNA cloning, functional expression, and mRNA tissue distribution of a third organellar Ca<sup>2+</sup> pump.</article-title>
          <source>J Biol Chem</source>
          <year>1989</year>
          <volume>264</volume>
          <fpage>18561</fpage>
          <lpage>18568</lpage>
          <pub-id pub-id-type="pmid">2553713</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Martin</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Bredoux</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Corvazier</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Papp</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Enouf</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title>Platelet Ca<sup>2+</sup> ATPases. A plural, species-specific, and multiple hypertension-regulated expression system.</article-title>
          <source>Hypertension</source>
          <year>2000</year>
          <volume>35</volume>
          <fpage>91</fpage>
          <lpage>102</lpage>
          <pub-id pub-id-type="pmid">10642281</pub-id>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lompre</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title>The sarco(endo)plasmic reticulum Ca<sup>2+</sup>-ATPases in the cardiovascular system during growth and proliferation.</article-title>
          <source>Trends in Cardiovascular Medicine</source>
          <year>1998</year>
          <volume>8</volume>
          <fpage>75</fpage>
          <lpage>82</lpage>
          <pub-id pub-id-type="doi">10.1016/S1050-1738(97)00130-810.1016/S1050-1738(97)00130-8</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wuytack</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Raeymaekers</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>De Smedt</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Eggermont</surname>
              <given-names>JA</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Ca<sup>2+</sup>-transport ATPases and their regulation in muscle and brain.</article-title>
          <source>Annals of New York Academy of Sciences</source>
          <year>1992</year>
          <volume>671</volume>
          <fpage>82</fpage>
          <lpage>91</lpage>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kuo</surname>
              <given-names>TH</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>B-F</given-names>
            </name>
            <name>
              <surname>Yu</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Wuytack</surname>
              <given-names>F</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Co-ordinated regulation of the plasma membrane calcium pump and the sarco(endo)plasmic reticular calcium pump gene expression by Ca<sup>2+</sup>.</article-title>
          <source>Cell Calcium</source>
          <year>1997</year>
          <volume>21</volume>
          <fpage>399</fpage>
          <lpage>408</lpage>
          <pub-id pub-id-type="pmid">9223676</pub-id>
        </citation>
      </ref>
      <ref id="B19">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Caspersen</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Pedersen</surname>
              <given-names>PS</given-names>
            </name>
            <name>
              <surname>Treiman</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <article-title>The Sarco-Endoplasmic Reticulum Calcium ATPase 2b is an endoplasmic reticulum stress-inducible protein.</article-title>
          <source>J Biol Chem</source>
          <year>2000</year>
          <volume>275</volume>
          <fpage>22363</fpage>
          <lpage>22372</lpage>
          <pub-id pub-id-type="pmid">10748035</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.M001569200</pub-id>
        </citation>
      </ref>
      <ref id="B20">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dode</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>De Greef</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Mountian</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Attard</surname>
              <given-names>M</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Structure of the human sarco/ endoplasmic reticulum Ca<sup>2+</sup>-ATPase 3 gene.</article-title>
          <source>J Biol Chem</source>
          <year>1998</year>
          <volume>273</volume>
          <fpage>13982</fpage>
          <lpage>13994</lpage>
          <pub-id pub-id-type="pmid">9593748</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.273.22.13982</pub-id>
        </citation>
      </ref>
      <ref id="B21">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rooney</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Meldolesi</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title>The endoplasmic reticulum in PC12 cells.</article-title>
          <source>J Biol Chem</source>
          <year>1996</year>
          <volume>271</volume>
          <fpage>29304</fpage>
          <lpage>29311</lpage>
          <pub-id pub-id-type="pmid">8910591</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.271.46.29304</pub-id>
        </citation>
      </ref>
      <ref id="B22">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Inesi</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Sagara</surname>
              <given-names>Y</given-names>
            </name>
          </person-group>
          <article-title>Specific inhibitors of intracellular Ca<sup>2+</sup> transport ATPases.</article-title>
          <source>J Membrane Biol</source>
          <year>1994</year>
          <volume>141</volume>
          <fpage>1</fpage>
          <lpage>6</lpage>
          <pub-id pub-id-type="pmid">7966241</pub-id>
        </citation>
      </ref>
      <ref id="B23">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Treiman</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Caspersen</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Christensen</surname>
              <given-names>SB</given-names>
            </name>
          </person-group>
          <article-title>A tool coming of age: thapsigargin as an inhibitor of sarco-endoplasmic reticulum Ca<sup>2+</sup>-ATPases.</article-title>
          <source>Trends Pharmacol Sci</source>
          <year>1998</year>
          <volume>19</volume>
          <fpage>131</fpage>
          <lpage>135</lpage>
          <pub-id pub-id-type="pmid">9612087</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0165-6147(98)01184-5</pub-id>
        </citation>
      </ref>
      <ref id="B24">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hasselbach</surname>
              <given-names>W</given-names>
            </name>
          </person-group>
          <article-title>Relaxing factor and the relaxation of muscle.</article-title>
          <source>Progress in Biophysics and Molecular Biology</source>
          <year>1964</year>
          <volume>14</volume>
          <fpage>169</fpage>
          <lpage>222</lpage>
        </citation>
      </ref>
      <ref id="B25">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bian</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Ghosh</surname>
              <given-names>TK</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>JC</given-names>
            </name>
            <name>
              <surname>Gill</surname>
              <given-names>DL</given-names>
            </name>
          </person-group>
          <article-title>Identification of intracellular calcium pools. Selective modification by thapsigargin.</article-title>
          <source>J Biol Chem</source>
          <year>1991</year>
          <volume>266</volume>
          <fpage>8801</fpage>
          <lpage>8806</lpage>
          <pub-id pub-id-type="pmid">1827436</pub-id>
        </citation>
      </ref>
      <ref id="B26">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Brostrom</surname>
              <given-names>MA</given-names>
            </name>
            <name>
              <surname>Cade</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Prostko</surname>
              <given-names>CR</given-names>
            </name>
            <name>
              <surname>Gmitter-Yellen</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Brostrom</surname>
              <given-names>CO</given-names>
            </name>
          </person-group>
          <article-title>Accomodation of protein synthesis to chronic deprivation of intracellular sequestered calcium.</article-title>
          <source>J Biol Chem</source>
          <year>1990</year>
          <volume>265</volume>
          <fpage>20539</fpage>
          <lpage>20546</lpage>
          <pub-id pub-id-type="pmid">2122977</pub-id>
        </citation>
      </ref>
      <ref id="B27">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>WW</given-names>
            </name>
            <name>
              <surname>Alexandre</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Cao</surname>
              <given-names>XJ</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>AS</given-names>
            </name>
          </person-group>
          <article-title>Transactivation of the grp78 promoter by Ca<sup>2+</sup> depletion.</article-title>
          <source>J Biol Chem</source>
          <year>1993</year>
          <volume>268</volume>
          <fpage>12003</fpage>
          <lpage>12009</lpage>
          <pub-id pub-id-type="pmid">8505325</pub-id>
        </citation>
      </ref>
      <ref id="B28">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Resendez</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Ting</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>KS</given-names>
            </name>
            <name>
              <surname>Wooden</surname>
              <given-names>SK</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>AS</given-names>
            </name>
          </person-group>
          <article-title>Calcium ionophore A23187 as a regulator of gene expression in mammalian cells.</article-title>
          <source>J Cell Biol</source>
          <year>1986</year>
          <volume>103</volume>
          <fpage>2145</fpage>
          <lpage>2152</lpage>
          <pub-id pub-id-type="pmid">3097027</pub-id>
        </citation>
      </ref>
      <ref id="B29">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Paschen</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Gissel</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Linden</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Doutheil</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title>Erp72 expression activated by transient cerebral ischemia or disturbance of neuronal endoplasmic reticulum calcium stores.</article-title>
          <source>Metab Brain Dis</source>
          <year>1998</year>
          <volume>13</volume>
          <fpage>55</fpage>
          <lpage>68</lpage>
          <pub-id pub-id-type="pmid">9570640</pub-id>
          <pub-id pub-id-type="doi">10.1023/A:1020631029168</pub-id>
        </citation>
      </ref>
      <ref id="B30">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Brostrom</surname>
              <given-names>CO</given-names>
            </name>
            <name>
              <surname>Brostrom</surname>
              <given-names>MA</given-names>
            </name>
          </person-group>
          <article-title>Regulation of translational initiation during cellular response to stress.</article-title>
          <source>Progress Nucl Acid Res Mol Biol</source>
          <year>1998</year>
          <volume>58</volume>
          <fpage>79</fpage>
          <lpage>125</lpage>
        </citation>
      </ref>
      <ref id="B31">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bennett</surname>
              <given-names>DL</given-names>
            </name>
            <name>
              <surname>Bootman</surname>
              <given-names>MD</given-names>
            </name>
            <name>
              <surname>Berridge</surname>
              <given-names>MJ</given-names>
            </name>
            <name>
              <surname>Cheek</surname>
              <given-names>TR</given-names>
            </name>
          </person-group>
          <article-title>Ca<sup>2+</sup> entry into PC12 cells initiated by ryanodine receptors or inositol 1,4,5-trisphosphate receptors.</article-title>
          <source>Biochem J</source>
          <year>1998</year>
          <volume>329</volume>
          <fpage>349</fpage>
          <lpage>357</lpage>
          <pub-id pub-id-type="pmid">9425119</pub-id>
        </citation>
      </ref>
      <ref id="B32">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Helenius</surname>
              <given-names>A</given-names>
            </name>
          </person-group>
          <article-title>How N-linked oligosaccharides affect glycoprotein folding in the endoplasmic reticulum.</article-title>
          <source>Mol Biol Cell</source>
          <year>1994</year>
          <volume>5</volume>
          <fpage>253</fpage>
          <lpage>265</lpage>
          <pub-id pub-id-type="pmid">8049518</pub-id>
        </citation>
      </ref>
      <ref id="B33">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sciaky</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Presley</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Lippincott-Schwartz</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>C</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Golgi tubule traffic and effects of brefeldin A visualized in living cells.</article-title>
          <source>J Cell Biol</source>
          <year>1997</year>
          <volume>139</volume>
          <fpage>1137</fpage>
          <lpage>1155</lpage>
          <pub-id pub-id-type="pmid">9382862</pub-id>
          <pub-id pub-id-type="doi">10.1083/jcb.139.5.1137</pub-id>
        </citation>
      </ref>
      <ref id="B34">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>East</surname>
              <given-names>JM</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>AG</given-names>
            </name>
          </person-group>
          <article-title>Lipid selectivity of the calcium and magnesium ion dependent adenosine trisphosphatase, studied with fluorescence quenching by a brominated phospholipid.</article-title>
          <source>Biochemistry</source>
          <year>1982</year>
          <volume>21</volume>
          <fpage>4144</fpage>
          <lpage>4151</lpage>
          <pub-id pub-id-type="pmid">6127102</pub-id>
        </citation>
      </ref>
      <ref id="B35">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Warren</surname>
              <given-names>GB</given-names>
            </name>
            <name>
              <surname>Toon</surname>
              <given-names>PA</given-names>
            </name>
            <name>
              <surname>Birsdall</surname>
              <given-names>NJ</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>AG</given-names>
            </name>
            <name>
              <surname>Metcalfe</surname>
              <given-names>JC</given-names>
            </name>
          </person-group>
          <article-title>Reconstitution of calcium pump using defined membrane components.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1974</year>
          <volume>71</volume>
          <fpage>622</fpage>
          <lpage>626</lpage>
          <pub-id pub-id-type="pmid">4274560</pub-id>
        </citation>
      </ref>
      <ref id="B36">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Andersen</surname>
              <given-names>JP</given-names>
            </name>
          </person-group>
          <article-title>Dissection of the functional domains of the sarcoplasmic reticulum Ca<sup>2+</sup> -ATPase by site-directed mutagenesis.</article-title>
          <source>Bioscience Reports</source>
          <year>1995</year>
          <volume>15</volume>
          <fpage>243</fpage>
          <lpage>261</lpage>
          <pub-id pub-id-type="pmid">8825028</pub-id>
        </citation>
      </ref>
      <ref id="B37">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Greene</surname>
              <given-names>LA</given-names>
            </name>
            <name>
              <surname>Aletta</surname>
              <given-names>JM</given-names>
            </name>
            <name>
              <surname>Rukenstein</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Green</surname>
              <given-names>SH</given-names>
            </name>
          </person-group>
          <article-title>PC12 pheochromocytoma cells: culture, nerve growth factor treatment, and experimental exploitation.</article-title>
          <source>Methods in Enzymol</source>
          <year>1987</year>
          <volume>147</volume>
          <fpage>207</fpage>
          <lpage>216</lpage>
          <pub-id pub-id-type="pmid">3670084</pub-id>
        </citation>
      </ref>
      <ref id="B38">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Balch</surname>
              <given-names>WE</given-names>
            </name>
            <name>
              <surname>Dunphy</surname>
              <given-names>WG</given-names>
            </name>
            <name>
              <surname>Braell</surname>
              <given-names>WA</given-names>
            </name>
            <name>
              <surname>Rothman</surname>
              <given-names>JE</given-names>
            </name>
          </person-group>
          <article-title>Reconstitution of the transport of protein between successive compartments of the Golgi measured by the coupled incorporation of N-acetylglucosamine.</article-title>
          <source>Cell</source>
          <year>1984</year>
          <volume>39</volume>
          <fpage>405</fpage>
          <lpage>416</lpage>
          <pub-id pub-id-type="pmid">6498939</pub-id>
        </citation>
      </ref>
      <ref id="B39">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Poulsen</surname>
              <given-names>J-CJ</given-names>
            </name>
            <name>
              <surname>Caspersen</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Mathiasen</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>East</surname>
              <given-names>MJ</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Thapsigargin-sensitive Ca<sup>2+</sup>-ATPases account for Ca<sup>2+</sup> uptake to inositol 1,4,5-trisphosphate-sensitive and caffeine-sensitive Ca<sup>2+</sup> stores in adrenal chromaffin cells.</article-title>
          <source>Biochem J</source>
          <year>1995</year>
          <volume>307</volume>
          <fpage>749</fpage>
          <lpage>758</lpage>
          <pub-id pub-id-type="pmid">7741706</pub-id>
        </citation>
      </ref>
      <ref id="B40">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fohr</surname>
              <given-names>KJ</given-names>
            </name>
            <name>
              <surname>Warchol</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Gratzl</surname>
              <given-names>M</given-names>
            </name>
          </person-group>
          <article-title>Calculation and control of free divalent cations in solutions used for membrane fusion studies.</article-title>
          <source>Methods in Enzymology</source>
          <year>1993</year>
          <volume>221</volume>
          <fpage>149</fpage>
          <lpage>157</lpage>
          <pub-id pub-id-type="pmid">8361372</pub-id>
        </citation>
      </ref>
      <ref id="B41">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bohlen</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Stein</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Dairman</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Udenfriend</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Fluorometric assay of proteins in the nanogram range.</article-title>
          <source>Arch Biochem Biophys</source>
          <year>1973</year>
          <volume>155</volume>
          <fpage>213</fpage>
          <lpage>220</lpage>
          <pub-id pub-id-type="pmid">4736505</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record><record><header><identifier>oai:pubmedcentral.nih.gov:31925</identifier><datestamp>2001-05-29</datestamp><setSpec>bmcbioc</setSpec><setSpec>pmc-open</setSpec></header><metadata><article xmlns="http://dtd.nlm.nih.gov/2.0/xsd/archivearticle" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://dtd.nlm.nih.gov/archiving/2.3/xsd/archivearticle.xsd" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="nlm-ta">BMC Biochem</journal-id>
      <journal-title>BMC Biochemistry</journal-title>
      <issn pub-type="epub">1471-2091</issn>
      <publisher>
        <publisher-name>BioMed Central</publisher-name>
        <publisher-loc>London</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="pmc">31925</article-id>
      <article-id pub-id-type="publisher-id">1471-2091-2-5</article-id>
      <article-id pub-id-type="pmid">11375052</article-id>
      <article-id pub-id-type="doi">10.1186/1471-2091-2-5</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Regulation of prostaglandin synthesis and cell adhesion by a tryptophan catabolizing enzyme</article-title>
      </title-group>
      <contrib-group>
        <contrib id="A1" corresp="yes" contrib-type="author">
          <name>
            <surname>Marshall</surname>
            <given-names>Brendan</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>marshall@immagene.mcg.edu</email>
        </contrib>
        <contrib id="A2" contrib-type="author">
          <name>
            <surname>Keskin</surname>
            <given-names>Derin Benerci</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>mp3940@medmail.mcg.edu</email>
        </contrib>
        <contrib id="A3" contrib-type="author">
          <name>
            <surname>Mellor</surname>
            <given-names>Andrew L</given-names>
          </name>
          <xref ref-type="aff" rid="I1">1</xref>
          <email>mellor@immagene.mcg.edu</email>
        </contrib>
      </contrib-group>
      <aff id="I1"><label>1</label>Program in Molecular Immunology, Institute for Molecular Medicine and Genetics, Medical College of Georgia, CB 2803, 1120 15th Street, Augusta, GA 30912-3175 USA</aff>
      <pub-date pub-type="collection">
        <year>2001</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>17</day>
        <month>5</month>
        <year>2001</year>
      </pub-date>
      <volume>2</volume>
      <fpage>5</fpage>
      <lpage>5</lpage>
      <ext-link ext-link-type="uri" xlink:href="http://www.biomedcentral.com/1471-2091/2/5"/>
      <history>
        <date date-type="received">
          <day>5</day>
          <month>4</month>
          <year>2001</year>
        </date>
        <date date-type="accepted">
          <day>17</day>
          <month>5</month>
          <year>2001</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright © 2001 Marshall et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-statement>
        <copyright-year>2001</copyright-year>
        <copyright-holder>Marshall et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</copyright-holder>
      </permissions>
      <abstract>
        <sec>
          <title>Background</title>
          <p>The tryptophan catabolizing enzyme, indoleamine 2,3, dioxygenase (IDO) is one of two mammalian enzymes, which can catabolize the rarest essential amino acid, tryptophan. IDO is inducible by cytokines such as interferon-γ and plays a role in inflammation and maternal tolerance of fetal allografts, although its exact mode of action is unclear. Therefore, we investigated the circumstances under which IDO is expressed <italic>in vitro</italic> together with the effects of overexpression of IDO on the growth and morphology of cells.</p>
        </sec>
        <sec>
          <title>Results</title>
          <p>Overexpression of IDO in the murine macrophage cell line RAW 264.7 and the murine fibrosarcoma cell line MC57, resulted in the growth of macroscopic cell foci, with altered cell adhesion properties. The expression of IDO was also detected during adhesion of wild type, nontransfected cells in tissue culture to standard cell growth substrates. Inhibition of this expression, likewise resulted in alterations in cell adhesion. Overexpression of IDO or inhibition of endogenous IDO expression was accompanied by changes in metalloproteinase expression and also in the expression and activity of the cyclooxygenase enzymes. In the case of RAW cells, IDO effects on cell growth could be reversed by adding back prostaglandins.</p>
        </sec>
        <sec>
          <title>Conclusions</title>
          <p>These results suggest that catabolism of the rarest essential amino acid may regulate processes such as cell adhesion and prostaglandin synthesis.</p>
        </sec>
      </abstract>
    </article-meta>
  </front>
  <body>
    <sec>
      <title>Background</title>
      <p>Two known enzymes catabolize the essential amino acid tryptophan in mammals. Tryptophan 2, 3 dioxygenase (TDO) is expressed predominantly in hepatic tissues and was the first inducible enzyme system discovered in mammals [<xref ref-type="bibr" rid="B1">1</xref>]. It controls serum tryptophan homeostasis and is induced following ingestion of tryptophan. A second enzyme, IDO, is distinguished from TDO by its expression pattern, substrate specificity and inducibility. IDO is expressed in a variety of non-hepatic tissues, including placenta, lung, gut and epididymis [<xref ref-type="bibr" rid="B2">2</xref>,<xref ref-type="bibr" rid="B3">3</xref>,<xref ref-type="bibr" rid="B4">4</xref>]. Except for the last named tissue where IDO is expressed constitutively, IDO is inducible by inflammatory mediators, including interferons. In addition, IDO catalyzes the breakdown of a variety of compounds which contain an indole ring, including D-tryptophan and serotonin, marking another difference from TDO, which is specific for L-tryptophan. Curiously, it appears as if tryptophan itself cannot induce IDO synthesis [<xref ref-type="bibr" rid="B5">5</xref>]. IDO is also suggested to be the evolutionary ancestor of certain novel myoglobins which occur in molluscs, marking IDO as an evolutionarily primitive enzyme [<xref ref-type="bibr" rid="B6">6</xref>].</p>
      <p>IDO is known to be expressed in cells infected with intracellular pathogens such as <italic>Toxoplasma</italic> and <italic>Chlamydia</italic> species and also by viruses [<xref ref-type="bibr" rid="B7">7</xref>,<xref ref-type="bibr" rid="B8">8</xref>,<xref ref-type="bibr" rid="B9">9</xref>,<xref ref-type="bibr" rid="B10">10</xref>]. In the case of <italic>Toxoplasma</italic> and <italic>Chlamydia</italic> it has been proposed that IDO induction is a cellular defense mechanism, designed to limit the proliferation of the invading pathogen by depleting the essential amino acid tryptophan. IDO expressed in monocyte derived macrophages has also been found to inhibit the growth of extracellular bacteria such as group B streptococci [<xref ref-type="bibr" rid="B11">11</xref>], and is also induced in tumors taken from cancer patients [<xref ref-type="bibr" rid="B12">12</xref>]. In all of these systems the proximal inducer of IDO activity is interferon-γ (IFN-γ). Response elements for this cytokine have been identified in the human IDO promoter and have been shown to be essential for IFN-γ induction of reporter gene expression <italic>in vitro</italic> [<xref ref-type="bibr" rid="B13">13</xref>,<xref ref-type="bibr" rid="B14">14</xref>,<xref ref-type="bibr" rid="B15">15</xref>].</p>
      <p>The unusual tissue distribution of IDO suggests that combating infection is not its only function. Our interest in IDO arose when we observed that tryptophan depletion was responsible for macrophage-induced inhibition of T cell proliferation <italic>in vitro</italic> [<xref ref-type="bibr" rid="B16">16</xref>]. Furthermore, we reported that a pharmacologic inhibitor of IDO, 1-methyl tryptophan, induced maternal rejection of allogeneic but not syngeneic murine fetuses [<xref ref-type="bibr" rid="B17">17</xref>]. As IDO is strongly expressed at the maternal-fetal interface in pregnant mice and women, we have suggested that IDO plays a role in fetal defense against the maternal immune system and could represent a novel means of immunoregulation. The apparently diverse functions and tissue distribution of IDO may have as a common theme the fact that tryptophan is the rarest essential amino acid and could be the target for cellular regulatory mechanisms. If so, tryptophan concentrations in cellular microenvironments might play a critical role in modulating various cellular processes in a way that cannot be achieved by the hepatic enzyme TDO which regulates systemic tryptophan concentrations.</p>
      <p>The IDO promoter contains a diverse collection of motifs together with the IFN-γ response elements. These include motifs for transcription factors that bind to collagenase and elastase genes and motifs for the transcription factor MEP-1, which regulates transcription from the <italic>stromelysin-1</italic> (MMP-3) and <italic>metallothionein</italic> genes [<xref ref-type="bibr" rid="B18">18</xref>,<xref ref-type="bibr" rid="B19">19</xref>]. Matrix metalloproteinases (MMPs) are responsible for modification of the extracellular matrix and are involved in wound healing, tumorigenesis, pregnancy and inflammation. In general, they regulate how cells interact with each other and with the extra-cellular matrix. Evidence for a tryptophan-reversible inhibition of MMP expression by IFN-γ has previously been presented [<xref ref-type="bibr" rid="B20">20</xref>, <xref ref-type="bibr" rid="B21">21</xref>], although the exact mechanism is unclear. Therefore we decided to directly test whether IDO plays a role in controlling interactions with other cells and also the surrounding extracellular environment.</p>
      <p>We have identified cells expressing IDO <italic>in vitro</italic> and used IDO antisense constructs to inhibit this expression. In addition, we have constitutively overexpressed IDO in adherent and non-adherent cell lines <italic>in vitro.</italic> Our results demonstrate that tryptophan catabolism has significant effects on cell adhesion and regulates the activity and expression of cyclooxygenases 1 and 2 (COX-1 and -2).</p>
    </sec>
    <sec>
      <title>Results</title>
      <sec>
        <title>Constitutive overexpression of IDO alters cell adhesion</title>
        <p>To determine whether IDO plays a role in regulating cell adhesion, we expressed a full-length IDO cDNA in cell lines <italic>in vitro</italic>. We transfected the murine macrophage cell line RAW 264.7 with a construct in which IDO was expressed under the control of the murine MHC Class II promoter (Fig <xref ref-type="fig" rid="F1">1A</xref>). IDO-transfected RAW cell clones, which expressed IDO under the control of the MHC Class II promoter, were characterized for IDO expression. We selected four clones with varying capacities for IDO expression and tryptophan depletion from culture medium (Fig <xref ref-type="fig" rid="F1">1B,C,D,E</xref>). Following 48 hours in culture, clones 22 and 11 depleted tryptophan to a greater extent than clones 6 and 8 or vector only control, consistent with the greater vector copy number of these clones. However, none of the clones depleted a substantial proportion of the tryptophan present in medium even with longer incubation times. A common feature of the tryptophan depleting clones was their tendency to form macroscopic foci, which were visible to the naked eye (Fig <xref ref-type="fig" rid="F2">2,A,B,C</xref>). At a certain point in focus growth, multicellular aggregates of RAW cells would break off from the focus and could be seen floating in suspension in the tissue culture medium. Wild type RAW cells or RAW cells transfected with vector alone and, to a lesser extent, clones 6 and 8 demonstrated a reduced ability to form macroscopic foci.</p>
        <fig position="float" id="F1">
          <label>Figure 1</label>
          <caption>
            <p><bold>Characterization of RAW cell transfectants</bold>. (A) IDO construct used to transfect RAW cells showing X, Y and W/S boxes of MHC Class II promoter. (B) Relative copy number determination of IDO-transfected RAW cell clones. The rabbit β globin intron present in the construct was used as a probe for hybridization by slot blot. (C) RT-PCR of total RNA isolated from RAW transfectants following 15 cycles of RT-PCR, electrophoresis on 0.8% agarose, followed by Southern blotting and hybridization with an IDO specific probe. (D) Western blot of IDO-expressing RAW cell transfectants, using IDO-specific polyclonal antibody. (E) HPLC determination of tryptophan depletion from tissue culture medium by IDO-expressing RAW cells, 48 hours post-seeding into fresh medium. V; Vector-only control transfectant. Clones 6, 8, 11, 22; IDO-expressing RAW clones.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-1"/>
        </fig>
        <fig position="float" id="F2">
          <label>Figure 2</label>
          <caption>
            <p><bold>Phenotype of IDO-expressing transfectants</bold>. (A) Flasks of RAW cell clones stained with trypan blue and photographed under normal light. Flasks are arranged in order of increasing IDO expression and show foci visible to the naked eye. V; Vector only control. (B) Vector-only transfected RAW cells. (C) Clone 11 IDO-expressing RAW cells. (D) Vector-only transfected MC57 cells. (E) IDO-expressing MC57 cell clone. Bar = 250 μm.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-2"/>
        </fig>
        <p>To determine if this phenomenon was unique to RAW cells, we also transfected the MC57 murine fibrosarcoma cell line [<xref ref-type="bibr" rid="B22">22</xref>] which grows as a monolayer. MC 57 cells are fibroblastic in appearance and disperse across the surface of a tissue culture dish in a uniform manner. Transfection of a full length, constitutively expressed IDO cDNA into MC57 cells in the pcDNA3 expression vector, resulted in MC57 cells developing a more rounded phenotype. Furthermore, cells grew as multicellular foci, in a confined area, similar to RAW cells, although the foci did not grow to as large a size before detaching from the plate (Fig <xref ref-type="fig" rid="F2">2D,E</xref>). The murine monocytic cell line P388 was also transfected and expressed IDO. It likewise exhibited a change in morphology similar to that described above and clones expressing IDO often changed from non-attached suspension cultures to adherent cultures which resembled RAW cells(not shown).</p>
        <p>IDO-expressing clones were also slower to re-attach to tissue culture dishes following sub-culture and could be seen floating as multicellular aggregates. To quantitate the change in cell adhesion in IDO-transfected RAW cells, we performed binding studies to tissue culture plates coated with various extra-cellular matrices, including collagen, laminin, matrigel, and fibronectin. Neither vector-only controls nor IDO-expressing cells adhered significantly to laminin or matrigel coated plates in a 45 minute assay period (not shown) and both controls and IDO-expressing cells adhered strongly and to similar extents to fibronectin coated plates (Fig <xref ref-type="fig" rid="F3">3A</xref>). However, there was a substantial difference in adhesion to collagen-coated plates. Although neither sample adhered to collagen to the same extent as to fibronectin, vector only controls adhered more strongly than IDO-expressing clone 11 (Fig <xref ref-type="fig" rid="F3">3B</xref>).</p>
        <fig position="float" id="F3">
          <label>Figure 3</label>
          <caption>
            <p><bold>Adhesion properties of IDO-expressing RAW cell transfectants</bold>. (A) Adhesion of clone 11 and vector-only RAW cells to fibronectin coated tissue culture dishes. 5 × 10<sup>5</sup> RAW cells were seeded into 24 well tissue culture plates coated with fibronectin and the percentage of cells adhering to the plate 45 minutes later was determined. (B) Adhesion of clone 11 and vector-only RAW cells to type I collagen-coated tissue culture dishes. Assay system was the same as for A.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-3"/>
        </fig>
      </sec>
      <sec>
        <title>IDO expression is induced during cell attachment to growth substrates</title>
        <p>To determine if IDO normally plays a role during the course of cell adhesion, we detached log phase, wild type RAW cells from their culture flasks by scraping, reseeded them into fresh medium and assayed for IDO expression at subsequent time points. Log phase cells do not express IDO at levels detectable by standard RT-PCR methods. However, in cells detached from their normal growth substrate, IDO expression was already induced by 5 hours following reseeding into fresh tissue culture dishes and expression was detected until 48 hours (Fig <xref ref-type="fig" rid="F4">4A</xref>). Onset of expression coincided with the time when the majority of cells had begun to adhere to the plate.</p>
        <fig position="float" id="F4">
          <label>Figure 4</label>
          <caption>
            <p><bold>IDO expression in RAW and P19 cells <italic>in vitro</italic></bold>. (A) RAW cells were harvested by scraping and 1 × 10<sup>6</sup> cells were seeded into 5 ml culture dishes. Cultures were harvested at various time points and assayed for IDO expression by RT-PCR. (B) P19 cells were aggregated in suspension cultures in the presence of either 1% DMSO or 10<sup>-6</sup> M RA. Cultures were harvested at various time points and assayed for IDO expression by RT-PCR. (C) Effect of EGTA on expression of IDO 24 hours following seeding of P19 aggregates. P19 cells were seeded into suspension cultures in the presence of 5 mM (lane 1), 3 mM(lane 2), 1 mM (lane 3) or no EGTA (lane 4). (D) IDO antisense expression. RT-PCR products electrophoresed on 0.8% agarose. Lanes; 1&amp;2: antisense clone C2, 3&amp;4: antisense clone D3, 5&amp;6: antisense clone E6, 7: molecular weight marker. Lanes marked with + or -; reverse transcriptase present or absent respectively.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-4"/>
        </fig>
        <p>To determine if IDO expression was restricted to cell interactions with standard tissue culture substrates and to further explore the possibility that IDO altered inter-cellular adhesiveness, we studied the murine embryonic carcinoma cell line P19. This cell has been characterized extensively and differentiates into skeletal and cardiac muscle or neuronal cells, depending on whether it is treated with DMSO or retinoic acid (RA) respectively [<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B24">24</xref>, <xref ref-type="bibr" rid="B25">25</xref>]. Differentiation is dependent on an initial, 3-5 day incubation as multicellular aggregates in suspension culture, in the presence of drug, followed by a similar period growing as monolayer adherent cells in the absence of drug. Mature differentiated cells begin to appear during this subsequent growth period in the absence of drug.</p>
        <p>IDO expression was detected when P19 cells were reseeded into bacterial petri dishes as suspension cultures and allowed to form aggregates. IDO expression was observed within 12 hours of seeding into suspension with DMSO and peaked around 48-54 hours. (Fig <xref ref-type="fig" rid="F4">4B</xref>). Thus, removing cells from their normal growth substrate and reseeding into fresh medium induced a burst of IDO expression irrespective of whether cells reassociated with tissue culture substrate or other cells. Aggregating cells in the presence of 10<sup>-6</sup> M RA, which induces neuronal differentiation also induced a transient burst of IDO transcription but the period was shorter and the peak level observed was lower than that observed with DMSO.</p>
        <p>To determine if IDO expression was related to the removal of cells from their normal growth substrate or the process of reattachment to new substrate, we trypsinized P19 cells and reseeded them as aggregates in suspension in the presence of various concentrations of EGTA. EGTA chelates essential Ca<sup>2+</sup> required by cadherin molecules and inhibits cell adhesion. We observed a concentration dependent decrease in IDO expression in EGTA treated samples 24 hours after seeding, which paralleled a corresponding decrease in cell aggregation (Fig <xref ref-type="fig" rid="F4">4C</xref>). Therefore, IDO expression appeared to be induced by reattachment, rather than detachment from a previous substrate. Thus, IDO is thus expressed endogenously in various cell types and is induced during cell attachment to growth substrates.</p>
      </sec>
      <sec>
        <title>Inhibition of endogenous IDO expression disrupts P19 cell adhesion</title>
        <p>To examine the role of IDO expression in P19 cells, we transfected P19 cells with a DNA construct which contained a 740 bp fragment of murine IDO cDNA in the antisense orientation, under the control of the constitutively active CMV promoter in the pcDNA-3 mammalian expression vector. As control, the IDO gene fragment was cloned in a sense orientation. To confirm that transfected, G418 resistant P19 cells expressed IDO antisense transcripts, we isolated total RNA from G418 resistant clones, reverse transcribed it into cDNA using a sense primer then PCR amplified the cDNA. Three antisense-transfected clones, which expressed progressively greater amounts of IDO antisense RNA were selected for further analysis together with a sense control (Fig <xref ref-type="fig" rid="F4">4D</xref>). The ability of the sense and antisense transfectants to deplete tryptophan from culture medium was determined following 48 hours in culture. IDO sense transfected P19 cells depleted 10% of available culture tryptophan (not shown) while IDO antisense transfected P19 clones which expressed high levels of antisense (clones D3 and E6) depleted essentially no tryptophan from the medium. Clone C2, which expressed low levels of IDO antisense, depleted similar levels of tryptophan to the sense control. Therefore, the burst of IDO expression, which takes place in cells during reattachment does not result in substantial tryptophan depletion from culture medium</p>
        <p>IDO antisense-transfected clones D3 and E6 exhibited a different phenotype compared to untransfected and sense transfected P19 cells (Fig <xref ref-type="fig" rid="F5">5A,B,C</xref>). IDO antisense expressing clones developed a rounded appearance with a more scattered morphology and apparent loss of cell interaction instead of the usual, adherent P19 phenotype. The degree to which this phenotype manifested, correlated with the extent of IDO antisense expression, i.e. it was prominent in clone E6 and D3 while clone C2 was indistinguishable from sense-transfected controls. However growth rates were largely unaltered. IDO-antisense and sense transfectants were aggregated in 1% DMSO and cell aggregates were visualized by phase contrast microscopy. Sense or untransfected P19 cells aggregated normally as tightly packed spheroid bodies. In contrast, antisense transfectants formed aggregates, which exhibited markedly different morphologies and differed from sense-transfected aggregates in two principal respects; shape and size (Fig <xref ref-type="fig" rid="F5">5D,E,F</xref>). At 30 hours after seeding suspension cultures, cells formed irregular shaped, non-spherical aggregates that were less tightly packed than control aggregates. Antisense clone E6 (shown in Fig. <xref ref-type="fig" rid="F5">5F</xref>) produced aggregates which were only loosely packed and a substantial number of cells which did not package into any form of aggregate while antisense clone D3 formed aggregates more diverse in shape than the uniformly spherical controls but less diverse than clone E6. Clone C2 produced aggregates similar to sense transfected controls (not shown).</p>
        <fig position="float" id="F5">
          <label>Figure 5</label>
          <caption>
            <p><bold>Phenotype of IDO-antisense transfected P19 cells</bold>. (A-C) P19 cells growing as a monolayer. (A) IDO-sense (B) IDO-antisense transfected P19 clone D3 (C) IDO antisense clone E6, growing as a monolayer. Bar:1 mm. (D-E); P19 cells growing as aggregates. (D) Aggregates from IDO sense-transfected P19 cells, (E) aggregates from IDO antisense-transfected P19 clone D3 grown in suspension for 30 hours in the presence of 1% DMSO. (F) Clone E6 treated as for D3. Bar: 50 mm (G) A representative field at 10x magnification was selected and the areas of 50 individual aggregates was calculated for both sense and antisense clone E6. Results are shown as the percentage of the total aggregates analyzed whose areas are within a given 0,2 sq. inch interval. (H) Percentage of IDO-sense and-antisense transfected P19 cells migrating to lower chamber of 24 well tissue culture plates18 hours following seeding. S: sense control, E6, D3, C2: antisense clones.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-5"/>
        </fig>
        <p>To quantitate and compare the size difference between sense and antisense-transfected aggregates we photographed sense and antisense clone 5 aggregates and calculated the area of each aggregate individually (Fig. <xref ref-type="fig" rid="F5">5G</xref>). Antisense aggregates were small, predominantly in the 0.2-0.4 sq. inch size range, whereas control aggregate sizes were spread over a much broader range. The mean size of antisense-transfected aggregates was 0.31 sq. inches, while sense transfected controls had a mean of 0.69 sq. inches (p &lt; 0.0001). The effect of IDO inhibition on cell adhesion was demonstrated by performing cell migration assays. P19 cells were seeded into porous tissue culture inserts placed in a 24 well tissue culture plate and cell migration to the lower chamber in the absence of any stimulus was determined. Approximately 12% of clone E6 cells migrated to the lower chamber 18 hours after seeding into the upper chamber (Fig. <xref ref-type="fig" rid="F5">5H</xref>). In contrast, less than1% of control cells had migrated in the same period. Clones C2 and D3 produced intermediate levels of migration. When inserts were coated with Matrigel, no significant migration was seen in either antisense or sense transfectants, indicating that cell motility could be inhibited by supplying an extracellular matrix.</p>
      </sec>
      <sec>
        <title>IDO axpression alters metalloproteinase expression</title>
        <p>The altered adhesion of IDO-expressing RAW cells to collagen suggested that IDO might induce alterations in enzymes involved in modifying the extracellular matrix. Therefore, we investigated whether inhibition of IDO expression in the P19 <italic>in vitro</italic> aggregation system and the constitutive overexpression of IDO in RAW cells had any effect on MMP expression. We allowed the sense and three-antisense expressing clones of P19 to aggregate in 1%. DMSO for 24 hours, before harvesting total RNA and determining expression of various MMP genes, including <italic>stromelysins 1</italic> (MMP-3), <italic>2</italic> (MMP-10) and <italic>3</italic> (MMP-11), <italic>collagenases I</italic> (MMP-1) and <italic>IV</italic> (MMP-2) and <italic>meltrins α</italic> (ADAM-12) and β (ADAM-19). <italic>Meltrin α</italic> is expressed <italic>in vivo</italic> during development in condensed mesenchymal cells that give rise to skeletal muscle while meltrin β is expressed in craniofacial and dorsal root ganglia where neuronal lineages differentiate [<xref ref-type="bibr" rid="B26">26</xref>]. Expression of <italic>stromelysin</italic>s-<italic>1</italic> and <italic>3</italic> and <italic>meltrin α</italic>, was increased in antisense-expressing aggregates, relative to the sense control (Fig <xref ref-type="fig" rid="F6">6A</xref>). Furthermore, there was a progressive increase in the expression level of these three protease genes, which correlated with the amount of IDO antisense expression. In contrast, the expression of <italic>meltri</italic>n-β and <italic>stromelysi</italic>n-<italic>2</italic> was similar in all samples and expression of <italic>collagenase I</italic> or <italic>IV</italic> was undetectable in either sense or antisense-expressing aggregates (not shown). Thus, inhibition of IDO gene expression correlated with increased expression of some but not all MMP genes in P19 cells undergoing aggregation. Furthermore, increased MMP expression coincided with decreased ability of P19 cells to aggregate in suspension culture. To determine whether IDO-expressing RAW cells also showed unusual MMP expression we tested the IDO-expressing RAW cell clones for the same group of MMPs as P19 cells. Expression of all MMPs was undetectable except for collagenase I. This showed significant expression in vector-only controls but little or no expression in IDO-expressing clones. All IDO-expressing clones demonstrated reduced expression with no correlation to the level of IDO expression (Fig <xref ref-type="fig" rid="F6">6B</xref>). Pharmacological inhibition of MMP activity in P19 cells using the broad spectrum, hydroxamic acid-based MMP inhibitor GM 6001 at concentrations ranging from 1-30 μM, resulted in partial reversal of the poor aggregation shown by IDO-AS expressing cells, with a maximal effect shown at 20 μM, indicating that changes in MMP expression were responsible, at least in part for altered cell adhesion.</p>
        <fig position="float" id="F6">
          <label>Figure 6</label>
          <caption>
            <p><bold>Effect of IDO on metalloproteinase expression</bold>. (A) IDO sense and antisense-transfected P19 cells were aggregated in 1% DMSO for 30 hours before total RNA was isolated and metalloproteinase gene expression assayed by RT-PCR. Lanes: 1-antisense clone E6, 2-antisense clone D3, 3-antisense clone C2, 4-sense. (B) Collagenase gene expression in IDO-expressing RAW transfectants. V: vector-only, 6,8, 11, 22: IDO expressing RAW clones.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-6"/>
        </fig>
      </sec>
      <sec>
        <title>IDO regulates prostaglandin synthesis</title>
        <p>To understand the mechanism of IDO induced alterations in cell adhesion and MMP expression, we attempted to reverse IDO effects on cell adhesion. As previously mentioned, tryptophan is not significantly depleted in culture medium of RAW cells overexpressing IDO, suggesting that tryptophan deprivation is not the cause of the IDO effect. Consistent with this, adding back tryptophan to IDO-expressing RAW cells did not reverse the growth of macroscopic foci. As tryptophan is not the only substrate for IDO, we also investigated whether adding serotonin would overcome the effects of IDO expression. There was a similar lack of effect of this compound. This suggested that depletion or reduction of an IDO substrate was probably not responsible for the effects described here. An alternative possibility was that a biologically active downstream catabolite of IDO could be the cause. Therefore, we tested the tryptophan catabolites, picolinic acid and quinolinic acid to see if they could reproduce the effects of IDO overexpression. Picolinic acid (1-6 mM) produced morphological changes in both MC57 and RAW cells and also substantial reductions in growth rate but did not mimic the effects of IDO expression. In particular, at a concentration of 2 mM, picolinic acid induced a more flattened phenotype. At concentrations above 6 mM, picolinic acid-induced apoptosis was observed. Quinolinic acid was essentially without effect at concentrations up to 10 mM. Therefore, the exact mode of action of IDO therefore remains to be determined.</p>
        <p>Despite the uncertainty about the proximal mediator of IDO's effect, it is known that alterations in cell adhesion and metalloproteinase activity are often associated with changes in prostaglandin synthesis [<xref ref-type="bibr" rid="B27">27</xref>,<xref ref-type="bibr" rid="B28">28</xref>,<xref ref-type="bibr" rid="B29">29</xref>,<xref ref-type="bibr" rid="B30">30</xref>]. Therefore, we analyzed the spectrum of PGs produced by IDO-expressing RAW cells using thin layer chromatography. PG D<sub>2</sub> was the major product of both vector-only controls and IDO-expressing clone 11, consistent with reports that D<sub>2</sub> production is typical of antigen-presenting cells [<xref ref-type="bibr" rid="B31">31</xref>]. There was a greater than 50% reduction in PG D<sub>2</sub> production in clone 11 compared with the vector only control and a similar decrease in levels of PGs F<sub>2α</sub>, 6keto-F<sub>1α</sub> and thromboxane B<sub>2</sub> in this clone (Fig <xref ref-type="fig" rid="F7">7A</xref>). However, PG E<sub>2</sub> production was affected relatively little compared to the other PGs. Thus IDO overexpression resulted in an increase in PG E<sub>2</sub> relative to the other PGs. However, in MC57 cells, the prostaglandin profile was quite different from that seen in RAW cells. PG E<sub>2</sub> was the dominant prostaglandin (Fig <xref ref-type="fig" rid="F7">7B</xref>) and overexpression of IDO resulted in a relative increase in the amount of PG D<sub>2</sub> and other PGs, relative to E<sub>2</sub>.</p>
        <fig position="float" id="F7">
          <label>Figure 7</label>
          <caption>
            <p><bold>Effect of IDO expression on prostaglandin production</bold>. (A) Analysis of prostaglandin production by vector-only transfected RAW cells () and IDO-expressing clone 11 () (B) Analysis of prostaglandin production by vector-only transfected () and clone 24 () IDO-expressing MC57 cells.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-7"/>
        </fig>
        <p>In IDO-expressing RAW cells, COX-1 protein levels were unchanged compared to the vector-only control (Fig <xref ref-type="fig" rid="F8">8A</xref>). In contrast, COX-2 was not expressed by vector only controls or RAW clones 6, 8 and 22 but COX-2 mRNA and protein was induced in the RAW clone expressing the greatest amount of IDO (clone 11) (Fig <xref ref-type="fig" rid="F8">8A</xref>). Although COX-2 is not usually expressed in RAW cells, it can be strongly induced with lipopolysaccharide (LPS) [<xref ref-type="bibr" rid="B32">32</xref>, <xref ref-type="bibr" rid="B33">33</xref>]. Therefore, we treated IDO transfected RAW cells and controls with LPS and measured COX-2 expression 24 hours later. COX-2 mRNA was most strongly induced in vector only or low IDO-expressing clones (Fig <xref ref-type="fig" rid="F8">8B</xref>). Curiously, clones expressing higher levels of IDO (clones 22 and 11) showed lower levels of COX-2 mRNA induction. In contrast, COX-2 protein levels were higher in clones expressing lower amounts of IDO mRNA and lower in vector only controls, whereas COX-1 protein levels were unchanged by LPS treatment. MC57 cells expressed COX-2 constitutively, consistent with the domination of the PG profile by PG E<sub>2</sub>. However, IDO overexpressing clone 26 showed a reduced amount of COX-2 protein compared to the vector only control (Fig <xref ref-type="fig" rid="F8">8C</xref>).</p>
        <fig position="float" id="F8">
          <label>Figure 8</label>
          <caption>
            <p><bold>Effect of IDO on cyclooxygenase expression clones</bold>. (A) Expression of COX-1 and COX-2 protein by vector-only transfected (Vo) and IDO expressing clones. (B) Effect of LPS treatment on expression of COX-1 and COX-2 in IDO-expressing clones. Vector-only and IDO-expressing RAW cells were treated with 1 ng/ml LPS for 12 hours. (C) COX-2 expression in vector-only or IDO-expressing MC57 cells.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-8"/>
        </fig>
        <p>If uniformly diminished PG synthesis by IDO was responsible for growth of RAW cell macroscopic foci, inhibiting PG synthesis with a pharmacological inhibitor of COX-1 and -2 ought to reproduce the effect of IDO expression. Therefore we treated vector-only transfected RAW cells with various concentrations of indomethacin ranging from 0.1 μM to 100 mM. Although some effect of indomethacin on cell growth rate was observed, there was no sign of macroscopic foci (data not shown). Thus IDO expression does not mimic the effects of a global COX inhibitor. To test the hypothesis that alterations in the relative levels of PGs were responsible for the growth of macroscopic foci, we added PGs directly to vector-only transfected RAW cells. The phenotype produced by IDO expression could be reproduced by adding PG E<sub>2</sub> alone to the cultures. PG E<sub>2</sub> addition resulted in a dose-dependent increase in the appearance of macroscopic foci, with visible foci appearing at 1 ng/ml (3 nM) and becoming abundant at 10 ng/ml (30 nM) (Fig. <xref ref-type="fig" rid="F9">9A</xref>). Adding PG F<sub>2α</sub> at the same time as E<sub>2</sub> resulted in a reduction of the number of foci. Surprisingly, addition of PG D<sub>2</sub> also resulted in a slight increase in focus numbers (not shown).</p>
        <fig position="float" id="F9">
          <label>Figure 9</label>
          <caption>
            <p><bold>Effect of exogenously added PGs on the growth of RAW cells</bold>. (A) Vector-only transfected RAW cells were incubated with the indicated concentrations of PGs for 48 hours and stained with trypan blue. (B) Clone 11 RAW cells were incubated with the indicated concentrations of PGs for 48 hours and stained as for A.</p>
          </caption>
          <graphic xlink:href="1471-2091-2-5-9"/>
        </fig>
        <p>We next attempted to reverse the phenotype seen in clone 11 cells. If increased PG E<sub>2</sub> production relative to other PGs was responsible for the appearance of macroscopic foci, then adding back increasing amounts of other PGs such as D<sub>2</sub> and F<sub>2α</sub> should restore the phenotype of clone 11 to that of vector only controls. As PG F<sub>2α</sub> attenuated the focus forming ability of PG E<sub>2</sub> in the experiment shown in Fig. <xref ref-type="fig" rid="F9">9A</xref>, we added PG F<sub>2α</sub> in various concentrations to clone 11 cells. PG F<sub>2α</sub> at 10 ng/ml (30 nM) substantially reduced the focus forming ability of IDO expressing clone 11 (Fig <xref ref-type="fig" rid="F9">9B</xref>). Thus an alteration in the PG E<sub>2</sub>/F<sub>2α</sub> ratio plays an important role in mediating IDO's effects on cell growth and morphology.</p>
      </sec>
    </sec>
    <sec>
      <title>Discussion</title>
      <p>Tryptophan catabolism by cells expressing IDO is something of an enigma and has resulted in speculation as to why the body requires two enzymes with different tissue specificities to degrade the rarest essential amino acid [<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B34">34</xref>]. The inability of IDO to be induced by its own substrate exemplifies this puzzle. While IDO's role in controlling intracellular pathogens is well documented, there is little understanding of the reasons for IDO expression at sites in the body unlikely to be related to this function, such as the epididymis. The data we present here reveal that IDO expression is an important determinant of the way in which cells interact with their extracellular environment <italic>in vitro</italic>. In particular, cell adhesion is altered dramatically by overexpressing IDO in cells which do not otherwise express it, or inhibiting IDO expression in cells in which it is naturally induced following cell passage. Specifically, overexpression of IDO in RAW and MC57 cells resulted in the growth of macroscopic foci and other phenotypic alterations. The cell foci were multicellular aggregates, which grew vertically as well as horizontally across the plate surface and contained significant numbers of necrotic cells within their interior, as judged by trypan blue exclusion. Conversely, in P19 cell aggregates in which IDO expression was inhibited, there was a more dispersed phenotype with cells losing the ability to interact with each other. We have recently confirmed that IDO expression in RAW cells following cell passage is likewise important for correct cell adhesion (results not shown).</p>
      <p>Our data support the hypothesis that IDO-induced alterations in PG synthesis can modify cell adhesion. We observed changes in the relative amounts of PGs in IDO-transfected RAW cells and reversal of the effects of IDO-expression by PG F<sub>2α</sub> while PG E<sub>2</sub> stimulated focus formation. COX-2 was upregulated in IDO-expressing RAW cells. Similar effects of PG E<sub>2</sub> on cell morphology have recently been reported in the human embryonic kidney cell line HEK 293, which overexpressed COX-2 and PG E<sub>2</sub> synthase [<xref ref-type="bibr" rid="B35">35</xref>]. COX-2/PG E<sub>2</sub> synthase-expressing cells were highly aggregated, piled up and exhibited round shape morphology similar to the RAW cells described here. MC57 cells, which demonstrated similar changes in cell adhesion to RAW cells following IDO expression, exhibited lower levels of COX-2 synthesis upon IDO expression and lower levels of PG E<sub>2</sub> relative to other PGs such as D<sub>2</sub>. Furthermore, adding back PGE<sub>2</sub> to IDO-expressing MC57 cells did not reproduce the wild type phenotype (not shown). Thus, similar effects on cell morphology were produced by opposite effects on COX-2 expression and PG E<sub>2</sub> production in these two cell lines. We are presently attempting to determine if products of COX-2 activity other than E<sub>2</sub> may be responsible for IDO effects in this cell line.</p>
      <p>The mechanism of PG-induced changes in cell adhesion and morphology may involve MMP activity. Synthesis of MMPs such as collagenase I (MMP-1), gelatinase B (MMP-9) and matrilysin (MMP-7) has been shown to be dependent on the synthesis of PG E<sub>2</sub>, suggesting that alterations in MMP expression may be instigated by alterations in PG synthesis [<xref ref-type="bibr" rid="B27">27</xref>,<xref ref-type="bibr" rid="B28">28</xref>,<xref ref-type="bibr" rid="B29">29</xref>,<xref ref-type="bibr" rid="B30">30</xref>]. Furthermore, both COX-1 and COX-2 have recently been shown to mediate adhesion of various cell types <italic>in vivo</italic> and <italic>in vitro</italic> [<xref ref-type="bibr" rid="B36">36</xref>, <xref ref-type="bibr" rid="B37">37</xref>]. Thus, one possibility is that alterations in MMP expression and activity could modify cellular interactions with the extracellular matrix following IDO expression. Consistent with this possibility is the observation that MMP expression in P19 cells was correlated with the degree of IDO-antisense expression. RAW transfectants over-expressing IDO showed reduced expression of collagenase I (MMP-1), and also bound less well to collagen-coated plates than controls. Collagen is one of the principal components of the extracellular matrix and RAW cells bind poorly to fibrillar type I collagen unless it is denatured or activated by collagenase [<xref ref-type="bibr" rid="B38">38</xref>]. Thus, the diminished expression of MMP-1 in IDO transfectants could explain their weaker binding to this substrate. The mechanism by which IDO regulates prostaglandin synthesis is yet to be determined. Tryptophan is a stimulatory co-factor for COX and degradation of tryptophan in the intracellular environment could alter COX activity. Alternatively, IDO might influence COX activity and expression through competition for or release of heme, which both enzymes require. <italic>In vitro</italic>, arachidonic acid stimulates the dissociation of heme from IDO and this correlates with IDO stimulatory effects on COX [<xref ref-type="bibr" rid="B39">39</xref>], providing circumstantial support for the latter possibility.</p>
      <p>The alterations in COX-2 expression observed in IDO-expressing RAW and MC57 cells are a particularly interesting feature of our results. COX-2 is inducible by a number of inflammatory mediators including IFN-γ [<xref ref-type="bibr" rid="B40">40</xref>] and LPS [<xref ref-type="bibr" rid="B32">32</xref>]. These also induce IDO. Treatment of IDO-expressing RAW clones with a known inducer of COX-2 (LPS), revealed a lack of correlation between COX-2 RNA and protein levels. Clones 11 and 22 showed low levels of COX-2 message but high levels of protein following LPS treatment. This suggests that COX-2 RNA and/or protein turnover may be affected by IDO expression. Other workers have noted that non-steroidal anti-inflammatory drugs, which inhibit COX activity result in increased COX protein expression [<xref ref-type="bibr" rid="B41">41</xref>], while differences between COX protein expression and activity have been reported to be produced by some cytokines, including tumor necrosis factor-α, and also nitric oxide donors [<xref ref-type="bibr" rid="B42">42</xref>, <xref ref-type="bibr" rid="B43">43</xref>]. Although not well understood, evidence for regulation of COX expression at the post-transcriptional level is increasing [<xref ref-type="bibr" rid="B44">44</xref>, <xref ref-type="bibr" rid="B45">45</xref>]. The down regulation of COX-2 transcripts in LPS-treated, IDO-expressing RAW cells is reminiscent of the endotoxin tolerance effect observed in human THP-1 promonocytic cells. Cells pretreated with LPS and thus expressing COX-2 showed down regulation of COX-2 mRNA when subjected to a second LPS exposure [<xref ref-type="bibr" rid="B46">46</xref>]. In addition, the COX-2 inhibitor flufenamic acid induced COX-2 expression in RAW cells but inhibited TNF-α or LPS-induced COX-2 expression in the same cell type [<xref ref-type="bibr" rid="B47">47</xref>].</p>
      <p>As both MMPs and COX-2 are important factors in tumor development [<xref ref-type="bibr" rid="B48">48</xref>, <xref ref-type="bibr" rid="B49">49</xref>] IDO's role in tumorigenesis bears investigating. We have observed IDO expression routinely in murine tumors <italic>in vivo</italic>, and are presently investigating the growth properties of tumors with altered IDO expression. In addition, our recent work indicates a role for IDO during pregnancy. Pharmacological inhibition of IDO results in pronounced inflammation, complement activation and fetal loss [<xref ref-type="bibr" rid="B17">17</xref>, <xref ref-type="bibr" rid="B50">50</xref>]. Prostaglandins may provide a common link between these important biological phenomena.</p>
    </sec>
    <sec>
      <title>Conclusions</title>
      <p>IDO regulates adhesion of cells to normal growth substrates. In so doing it modulates the expression and activity of COX-2 and certain MMPs. RAW cells and MC57 cells overexpressing IDO grew as multicellular foci. In the case of RAW cells, this was due to elevated PGE relative to other prostaglandins. P19 cells in which endogenousIDO expression was disrupted by antisense expression, showed lower adhesiveness. Thus, tryptophan catabolism exerts control over fundamental cellular functions.</p>
    </sec>
    <sec sec-type="materials|methods">
      <title>Materials and Methods</title>
      <sec>
        <title>Cells</title>
        <p>P19 cells were obtained from the American Type Culture Collection and cultured as described [<xref ref-type="bibr" rid="B23">23</xref>]. Cells were differentiated into myocytes or neurones using 1% DMSO and 10<sup>-6</sup> M RA respectively as previously reported [<xref ref-type="bibr" rid="B23">23</xref>, <xref ref-type="bibr" rid="B24">24</xref>]. RAW 264.7 cells were a gift of Dr. D. Greaves (Oxford, England) and were cultured in Iscove's Modified Dulbecco's Medium supplemented with 10% fetal calf serum. MC57 cells were obtained from Dr. Dimitrios Moskiphidis, Medical College of Georgia and grown in Iscove's Modified Dulbecco's Medium.</p>
      </sec>
      <sec>
        <title>IDO expression</title>
        <p>A full length, 1.2 kb IDO cDNA was amplified from IFN-γ stimulated RAW cells and cloned into pGEM T-Easy (Promega), using primers; 5' TAG CGG CCG CGT AGA CAG CAA TGG CAC TC 3' forward, 5' TAA GAT CTT ACA CTA AGG CCA ACT CAG 3' reverse, which contain Not I and Bgl II sites respectively. The 1.2 kb IDO PCR fragment was excised with Not I and Bgl II and cloned into the Not I-Bgl II site in the pDOI vector [<xref ref-type="bibr" rid="B51">51</xref>], previously modified by the introduction of a Not I site in front of the Eco RI cloning site. Plasmid DNA was linearized and transfected into RAW cells by electroporation. Stably transfected lines were selected in 400 mg/ml G418 and thereafter maintained in 200 mg/ml G418. MC57 cells were also transfected by electroporation and selected in 1.2 mg/ml G418.</p>
      </sec>
      <sec>
        <title>RT-PCR</title>
        <p>Analysis of gene expression in P19 or RAW cells was performed using semi-quantitative RT-PCR. Total RNA was isolated from cells using RNA STAT-60 (Tel-Test Inc.) and 1 mg was amplified for 25 cycles unless otherwise stated, following reverse transcription in a one step reaction (RT-PCR "Access", Promega). 5 μl of the 50 ml reaction volume was electrophoresed on 0.8% agarose gels prior to Southern blotting and hybridization with a specific probe. Primers and amplification conditions for IDO amplification have been described elsewhere [<xref ref-type="bibr" rid="B17">17</xref>]. Primers for amplification of other gene specific transcripts were as follows; stromelysin-1; 5' GATGACAGGGAAGCTGGA forward, 5' ACTGCGAAGATCCACTGA reverse. Stromelysin-2; 5' GATGTACCCAGTCTACAGGT 3' forward, 5' TGTCTTGTCTCATCATTACT 3' reverse. Stromelysin-3; 5' CTGCTGCTCCTGTTGCTGCT 3' forward, 5' ACCTTGGAAGAACCAAATC 3' reverse. Meltrin-α; 5' TGCATCAGTGGTCAGCCTCA 3' forward, 5' CTTTCTCTGCGGCCATTCTG 3' reverse. Meltrin-β; 5' TTCAGTTTACACATCAGAC 3' forward, 5' AGGTCACATTGCCGAACCT 3' reverse. Collagenase I; 5' GATTGTGAACTATACTCCT 3' forward, 5' CCATAGTCTGGTTAACATCA 3' reverse. Collagenase IV; 5' GTATGGAGCGACGTCACT 3' forward, 5' CGCTCCAGAGTGCTGGCA 3' reverse. GAPDH; 5' TGCAGTGGCAAAGTGGAG 3' forward 5' CCATCCACAGTCTTCTG 3' reverse.</p>
      </sec>
      <sec>
        <title>Antisense inhibition of IDO expression</title>
        <p>Constructs which expressed either sense or antisense IDO RNA were produced by cloning a 740 bp RT-PCR fragment of the IDO gene, described in [<xref ref-type="bibr" rid="B17">17</xref>], into the T-tailed cloning vector pGEM T-Easy (Promega). This fragment was excised with Not I and subcloned into the Not I site of the mammalian expression vector pcDNA3 (Invitrogen), in either the sense or antisense orientation. Following linearization with Bgl II, the constructs were transfected into the P19 cell line using Lipofectamine (Gibco-BRL) at a concentration of 25 μl per 100 ml of serum free medium. Stable transfectants were selected in 400 mg/ml G418 over a period of 4 weeks and subsequently maintained in the absence of G418 in normal growth medium. Periodic checks of G418 resistance revealed no significant loss of the resistance phenotype. Confirmation that resisitant clones expressed IDO antisense RNA was obtained by isolating total RNA from G418 resistant clones, treating with ribonuclease free DNase RQ1 (Promega) and reverse transcribing RNA into cDNA in the presence of an IDO sense primer [<xref ref-type="bibr" rid="B17">17</xref>]. An antisense primer was then added and the cDNA PCR amplified for 25 cycles. Products were electrophoresed in 0.8% agarose.</p>
      </sec>
      <sec>
        <title>Western blotting</title>
        <p>RAW cells expressing IDO and vector only controls were harvested in cell lysis buffer (PBS, 1%NP40, 0.5% sodium deoxycholate, 0.1% SDS, 150 ng/ml PMSF, 100 ng/ml aprotinin) and 25 μg of cell protein was electrophoresed on 10% polyacrylamide gels overlayed with a 5% stacking gel. Protein was quantitated using the BCA assay (Pierce). COX-1 and COX-2 antibodies (Santa Cruz Biotechnology Inc) were used in combination with standard ECL techniques. Rabbit polyclonal IDO-specific antibody was generated against a C-terminal peptide of 42 amino acids; KPSKKKPTDGDKSEEPSNVESRGTGGTNPMTELRSVKDTTEK.</p>
      </sec>
      <sec>
        <title>Measurement of tryptophan depletion by HPLC</title>
        <p>Supernatants from cell cultures were extracted with HPLC grade methanol and analyzed on a Beckman Phenomenix C18(2) HPLC column and eluted with a 0-80% gradient of acetonitrile over 20 minutes. To validate retention times and for the construction of a concentration curve a standard mixture of kynurenine and tryptophan was analyzed for each assay.</p>
      </sec>
      <sec>
        <title>Analysis of prostaglandin production</title>
        <p>Prostaglandin synthesis was measured by pulsing IDO-expressing RAW cells and vector only controls with <sup>14</sup>C arachidonic acid (Sigma). 5 × 10<sup>6</sup> cells were harvested and resuspended in PBS and incubated at 37°C with 1.3 mCi arachidonic acid (53 mCi/mmol) for 30 mins. Following ether extraction, samples were dissolved in ethyl acetate and spotted onto thin layer chromatography plates. Plates were developed in ethyl acetate: acetic acid, 90:1, together with unlabeled standards. Individual spots were excised from the chromatogram and radioactivity determined by scintillation counting.</p>
      </sec>
      <sec>
        <title>Cell adhesion assay</title>
        <p>Cell adhesion assays were performed essentially as described [<xref ref-type="bibr" rid="B36">36</xref>]. Briefly, cells were seeded into the wells of a 24 well plate coated with various growth substrates Following incubation at 37°C, for 45 minutes, cells unattached cells were removed by PBS washes and the remaining cells were counted.</p>
      </sec>
      <sec>
        <title>Cell migration assay</title>
        <p>P19 cells in log phase growth were trypsinized and 10<sup>5</sup> were seeded in quadruplicate into Falcon cell culture inserts, with or without Matrigel coating (Becton Dickinson, Franklin Lakes, NJ, 8.0 μm pore size, 1 × 10<sup>5</sup>pores/sq.cm), in a volume of 0.2 ml, in a 24 well tissue culture plate. The lower chamber contained a volume of 0.8 ml growth medium, while the final volume in the upper chamber was 0.35 ml. Chambers were incubated for 18 hours after which time the number of cells in the lower chamber was determined.</p>
      </sec>
      <sec>
        <title>Image analysis</title>
        <p>The size of individual P19 aggregates was determined by capturing fields of 40-50 aggregates at 10x magnification and then calculating the area of each aggregate using the NIH Image (1.62) analysis program (<ext-link ext-link-type="uri" xlink:href="http://rsb.info.nih.gov/nih-image/download.html"/>).</p>
      </sec>
    </sec>
    <sec>
      <title>Abbreviations</title>
      <p>CMV: cytomegalovirus</p>
      <p>COX: cyclooxygenase</p>
      <p>IDO: indoleamine 2,3 dioxygenase</p>
      <p>IFN-γ interferon gamma</p>
      <p>LPS: lipopolysaccharide</p>
      <p>MMP: matrix metalloproteinase</p>
      <p>NSAID: non-steroidal anti-inflammatory drug</p>
      <p>PG: prostaglandin</p>
      <p>TDO: tryptophan 2, 3 dioxygenase</p>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgements</title>
        <p>We wish to thank Anita Wylds, Carolyn Leithner and John Nechtman for expert technical assistance and Dr. Steve Vogel for assistance with image analysis. These studies were supported by grants AA44219 and AI 42247 from the National Institutes of Health to ALM, the Departments of Medicine, Medical College of Georgia and generous support from the Carlos and Marguerite Mason Trust.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="B1">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kotake</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Masayama</surname>
              <given-names>T</given-names>
            </name>
          </person-group>
          <article-title>Uber den mechanismus der kynurein-bildung aus tryptophan.</article-title>
          <source>Hoppe-Seyler's Z Physiol Chem</source>
          <year>1937</year>
          <volume>243</volume>
          <fpage>237</fpage>
          <lpage>244</lpage>
        </citation>
      </ref>
      <ref id="B2">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shimizu</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Nomiyama</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Hirata</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Hayaishi</surname>
              <given-names>O</given-names>
            </name>
          </person-group>
          <article-title>Indoleamine 2,3 dioxygenase. Purification and some properties.</article-title>
          <source>J Biol Chem</source>
          <year>1978</year>
          <volume>253</volume>
          <fpage>4700</fpage>
          <lpage>4706</lpage>
          <pub-id pub-id-type="pmid">26687</pub-id>
        </citation>
      </ref>
      <ref id="B3">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yoshida</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Nukiwa</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Watanabe</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Fujiwara</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Hirata</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Hayaishi</surname>
              <given-names>O</given-names>
            </name>
          </person-group>
          <article-title>Regulation of indoleamine 2,3 dioxygenase activity in the small intestine and epididymis of mice.</article-title>
          <source>Arch Biochem Biophys</source>
          <year>1980</year>
          <volume>203</volume>
          <fpage>343</fpage>
          <lpage>351</lpage>
          <pub-id pub-id-type="pmid">6967714</pub-id>
          <pub-id pub-id-type="doi">10.1016/0003-9861(80)90185-X</pub-id>
        </citation>
      </ref>
      <ref id="B4">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yamazaki</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Kuroiwa</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Takikawa</surname>
              <given-names>O</given-names>
            </name>
            <name>
              <surname>Kido</surname>
              <given-names>R</given-names>
            </name>
          </person-group>
          <article-title>Human indolylamine 2,3 dioxygenase. Its tissue distribution, and characterization of the placental enzyme.</article-title>
          <source>Biochem J</source>
          <year>1985</year>
          <volume>230</volume>
          <fpage>635</fpage>
          <lpage>638</lpage>
          <pub-id pub-id-type="pmid">3877502</pub-id>
        </citation>
      </ref>
      <ref id="B5">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Taylor</surname>
              <given-names>MW</given-names>
            </name>
            <name>
              <surname>Feng</surname>
              <given-names>G</given-names>
            </name>
          </person-group>
          <article-title>Relationship between interferon-γ, indoleamine 2,3 dioxygenase and tryptophan catabolism.</article-title>
          <source>FASEB J</source>
          <year>1991</year>
          <volume>5</volume>
          <fpage>2516</fpage>
          <lpage>2522</lpage>
          <pub-id pub-id-type="pmid">1907934</pub-id>
        </citation>
      </ref>
      <ref id="B6">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Suzuki</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Takagi</surname>
              <given-names>T</given-names>
            </name>
          </person-group>
          <article-title>A myoglobin evolved from indoleamine 2,3 dioxygenase.</article-title>
          <source>J Mol Biol</source>
          <year>1992</year>
          <volume>228</volume>
          <fpage>698</fpage>
          <lpage>700</lpage>
          <pub-id pub-id-type="pmid">1453473</pub-id>
          <pub-id pub-id-type="doi">10.1016/0022-2836(92)90854-D</pub-id>
        </citation>
      </ref>
      <ref id="B7">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yoshida</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Urade</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Tokuda</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Hayaishi</surname>
              <given-names>O</given-names>
            </name>
          </person-group>
          <article-title>Induction of indoleamine 2,3 dioxygenase in mouse lung during virus infection.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1979</year>
          <volume>76</volume>
          <fpage>4084</fpage>
          <lpage>4086</lpage>
          <pub-id pub-id-type="pmid">291064</pub-id>
        </citation>
      </ref>
      <ref id="B8">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Byrne</surname>
              <given-names>GI</given-names>
            </name>
            <name>
              <surname>Lehman</surname>
              <given-names>LK</given-names>
            </name>
            <name>
              <surname>Landry</surname>
              <given-names>GJ</given-names>
            </name>
          </person-group>
          <article-title>Induction of tryptophan catabolism is the mechanism for gamma interferon-mediated inhibition of intracellular <italic>Chlamydia psittaci</italic> replication in T24 cells.</article-title>
          <source>Infect Immun</source>
          <year>1986</year>
          <volume>53</volume>
          <fpage>347</fpage>
          <lpage>351</lpage>
          <pub-id pub-id-type="pmid">3089936</pub-id>
        </citation>
      </ref>
      <ref id="B9">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shemer-Avni</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Wallach</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Sariv</surname>
              <given-names>I</given-names>
            </name>
          </person-group>
          <article-title>Reversal of the antichlamydial effect of tumor necrosis factor by tryptophan and antibodies to beta interferon.</article-title>
          <source>Infect Immun</source>
          <year>1989</year>
          <volume>57</volume>
          <fpage>3484</fpage>
          <lpage>3490</lpage>
          <pub-id pub-id-type="pmid">2509363</pub-id>
        </citation>
      </ref>
      <ref id="B10">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Pfefferkorn</surname>
              <given-names>ER</given-names>
            </name>
          </person-group>
          <article-title>Interferon-γ blocks the growth of <italic>Toxoplasma gondii</italic> in human fibroblasts by inducing the host cell to degrade tryptophan.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1994</year>
          <volume>81</volume>
          <fpage>908</fpage>
          <lpage>912</lpage>
          <pub-id pub-id-type="pmid">6422465</pub-id>
        </citation>
      </ref>
      <ref id="B11">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>MacKenzie</surname>
              <given-names>CR</given-names>
            </name>
            <name>
              <surname>Hadding</surname>
              <given-names>U</given-names>
            </name>
            <name>
              <surname>Daubener</surname>
              <given-names>W</given-names>
            </name>
          </person-group>
          <article-title>Interferon-gamma-induced activation of indoleamine 2,3-dioxygenase in cord blood monocyte-derived macrophages inhibits the growth of group B streptococci.</article-title>
          <source> J Infect Dis</source>
          <year>1998</year>
          <volume>178</volume>
          <fpage>875</fpage>
          <lpage>878</lpage>
          <pub-id pub-id-type="pmid">9728563</pub-id>
        </citation>
      </ref>
      <ref id="B12">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yasui</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Takai</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Yoshida</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Hayaishi</surname>
              <given-names>O</given-names>
            </name>
          </person-group>
          <article-title>Interferon enhances tryptophan metabolism by inducing pulmonary indoleamine 2, 3 dioxygenase.</article-title>
          <source>Proc Natl Acad Sci USA</source>
          <year>1986</year>
          <volume>83</volume>
          <fpage>6622</fpage>
          <lpage>6626</lpage>
          <pub-id pub-id-type="pmid">2428037</pub-id>
        </citation>
      </ref>
      <ref id="B13">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hassanain</surname>
              <given-names>HH</given-names>
            </name>
            <name>
              <surname>Chon</surname>
              <given-names>SY</given-names>
            </name>
            <name>
              <surname>Gupta</surname>
              <given-names>SL</given-names>
            </name>
          </person-group>
          <article-title>Differential regulation of human indoleamine 2,3 dioxygenase gene expression by interferons γ and α.</article-title>
          <source> J Biol Chem</source>
          <year>1993</year>
          <volume>268</volume>
          <fpage>5077</fpage>
          <lpage>5084</lpage>
          <pub-id pub-id-type="pmid">8444884</pub-id>
        </citation>
      </ref>
      <ref id="B14">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chon</surname>
              <given-names>SY</given-names>
            </name>
            <name>
              <surname>Hassanain</surname>
              <given-names>HH</given-names>
            </name>
            <name>
              <surname>Gupta</surname>
              <given-names>SL</given-names>
            </name>
          </person-group>
          <article-title>Cooperative role of interferon regulatory factor 1 and p91(STAT 1) responsive elements in interferon-γ inducible expression of indoleamine 2, 3 dioxygenase.</article-title>
          <source>J Biol Chem</source>
          <year>1996</year>
          <volume>271</volume>
          <fpage>17247</fpage>
          <lpage>17252</lpage>
          <pub-id pub-id-type="pmid">8663541</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.271.29.17247</pub-id>
        </citation>
      </ref>
      <ref id="B15">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Konan</surname>
              <given-names>KV</given-names>
            </name>
            <name>
              <surname>Taylor</surname>
              <given-names>MW</given-names>
            </name>
          </person-group>
          <article-title>Importance of two interferon-stimulated response element sequences in the regulation of the human indoleamine 2, 3 dioxygenase gene.</article-title>
          <source>J Biol Chem</source>
          <year>1996</year>
          <volume>271</volume>
          <fpage>19140</fpage>
          <lpage>19145</lpage>
          <pub-id pub-id-type="pmid">8702590</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.271.32.19140</pub-id>
        </citation>
      </ref>
      <ref id="B16">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Munn</surname>
              <given-names>DH</given-names>
            </name>
            <name>
              <surname>Shafizadeh</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Attwood</surname>
              <given-names>JT</given-names>
            </name>
            <name>
              <surname>Bondarev</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Pashine</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Mellor</surname>
              <given-names>AL</given-names>
            </name>
          </person-group>
          <article-title>Inhibition of T cell proliferation by macrophage tryptophan catabolism.</article-title>
          <source>J Exp Med</source>
          <year>1999</year>
          <volume>189</volume>
          <fpage>1363</fpage>
          <lpage>1372</lpage>
          <pub-id pub-id-type="pmid">10224276</pub-id>
          <pub-id pub-id-type="doi">10.1084/jem.189.9.1363</pub-id>
        </citation>
      </ref>
      <ref id="B17">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Munn</surname>
              <given-names>DH</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Attwood</surname>
              <given-names>JT</given-names>
            </name>
            <name>
              <surname>Bondarev</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Conway</surname>
              <given-names>SJ</given-names>
            </name>
            <name>
              <surname>Marshall</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Mellor</surname>
              <given-names>AL</given-names>
            </name>
          </person-group>
          <article-title>Prevention of allogeneic fetal rejection by tryptophan catabolism.</article-title>
          <source>Science</source>
          <year>1998</year>
          <volume>281</volume>
          <fpage>1191</fpage>
          <lpage>1193</lpage>
          <pub-id pub-id-type="pmid">9712583</pub-id>
          <pub-id pub-id-type="doi">10.1126/science.281.5380.1191</pub-id>
        </citation>
      </ref>
      <ref id="B18">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Labbe</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Larouche</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Mailhot</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Seguin</surname>
              <given-names>C</given-names>
            </name>
          </person-group>
          <article-title>Purification of mouse MEP-1 nuclear protein which binds to the metal regulatory elements of genes encoding metallothionein.</article-title>
          <source>Nucl Acids Res</source>
          <year>1993</year>
          <volume>94</volume>
          <fpage>1549</fpage>
          <lpage>1554</lpage>
          <pub-id pub-id-type="pmid">8479904</pub-id>
        </citation>
      </ref>
      <ref id="B19">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yee</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Kuncio</surname>
              <given-names>GS</given-names>
            </name>
            <name>
              <surname>Bhandari</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Shihab</surname>
              <given-names>FS</given-names>
            </name>
            <name>
              <surname>Neilson</surname>
              <given-names>EG</given-names>
            </name>
          </person-group>
          <article-title>Identification of promoter activity and differential expression of transcripts encoding the murine stromelysin gene in renal cells.</article-title>
          <source>Kidney Int</source>
          <year>1997</year>
          <volume>52</volume>
          <fpage>120</fpage>
          <lpage>129</lpage>
          <pub-id pub-id-type="pmid">9211354</pub-id>
        </citation>
      </ref>
      <ref id="B20">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Varga</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Yufit</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>RR</given-names>
            </name>
          </person-group>
          <article-title>Inhibition of collagenase and stromelysin gene expression by interferon-γ in human dermal fibroblasts is mediated in part via tryptophan degradation.</article-title>
          <source>J Clin Invest</source>
          <year>1995</year>
          <volume>96</volume>
          <fpage>475</fpage>
          <lpage>481</lpage>
          <pub-id pub-id-type="pmid">7615820</pub-id>
        </citation>
      </ref>
      <ref id="B21">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Varga</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Yufit</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Hitraya</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>RR</given-names>
            </name>
          </person-group>
          <article-title>Control of extracellular matrix degradation by interferon gamma. The tryptophan connection.</article-title>
          <source>Adv Exp Med Biol</source>
          <year>1996</year>
          <volume>398</volume>
          <fpage>143</fpage>
          <lpage>148</lpage>
          <pub-id pub-id-type="pmid">8906257</pub-id>
        </citation>
      </ref>
      <ref id="B22">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cornain</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Klein</surname>
              <given-names>E</given-names>
            </name>
          </person-group>
          <article-title>Characteristics and in vitro growth influencing effects of the spleen cell population in a methylcholanthrene induced mouse sarcoma system.</article-title>
          <source>Z Immunitatsforsch Immunobiol</source>
          <year>1978</year>
          <volume>154</volume>
          <fpage>101</fpage>
          <lpage>114</lpage>
          <pub-id pub-id-type="pmid">306157</pub-id>
        </citation>
      </ref>
      <ref id="B23">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>McBurney</surname>
              <given-names>MW</given-names>
            </name>
            <name>
              <surname>Jones-Villeneuve</surname>
              <given-names>EMV</given-names>
            </name>
            <name>
              <surname>Edwards</surname>
              <given-names>MKS</given-names>
            </name>
            <name>
              <surname>Anderson</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <article-title>Control of muscle and neuronal differentiation in a cultured embryonal carcinoma cell line.</article-title>
          <source>Nature</source>
          <year>1982</year>
          <volume>299</volume>
          <fpage>165</fpage>
          <lpage>167</lpage>
          <pub-id pub-id-type="pmid">7110336</pub-id>
          <pub-id pub-id-type="doi">10.1038/299165a0</pub-id>
        </citation>
      </ref>
      <ref id="B24">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jones-Villeneuve</surname>
              <given-names>EMV</given-names>
            </name>
            <name>
              <surname>McBurney</surname>
              <given-names>MW</given-names>
            </name>
            <name>
              <surname>Rogers</surname>
              <given-names>KA</given-names>
            </name>
            <name>
              <surname>Kalnins</surname>
              <given-names>VI</given-names>
            </name>
          </person-group>
          <article-title>Retinoic Acid induces embryonal carcinoma cells to differentiate into neurons and glial cells.</article-title>
          <source>J Cell Biol</source>
          <year>1982</year>
          <volume>94</volume>
          <fpage>253</fpage>
          <lpage>262</lpage>
          <pub-id pub-id-type="pmid">7107698</pub-id>
          <pub-id pub-id-type="doi">10.1083/jcb.94.2.253</pub-id>
        </citation>
      </ref>
      <ref id="B25">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Edwards</surname>
              <given-names>MK</given-names>
            </name>
            <name>
              <surname>Harris</surname>
              <given-names>JF</given-names>
            </name>
            <name>
              <surname>McBurney</surname>
              <given-names>MW</given-names>
            </name>
          </person-group>
          <article-title>Induced muscle differentiation in an embryonal carcinoma cell line.</article-title>
          <source>Mol Cell Biol</source>
          <year>1983</year>
          <volume>3</volume>
          <fpage>2280</fpage>
          <lpage>2286</lpage>
          <pub-id pub-id-type="pmid">6656767</pub-id>
        </citation>
      </ref>
      <ref id="B26">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kurisaki</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Masuda</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Osumi</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Nabeshima</surname>
              <given-names>Y</given-names>
            </name>
          </person-group>
          <article-title>Spatially and temporally restricted expression of meltrin alpha (ADAM 12) and beta (ADAM 19) in mouse embryo.</article-title>
          <source>Mech Dev</source>
          <year>1998</year>
          <volume>73</volume>
          <fpage>211</fpage>
          <lpage>215</lpage>
          <pub-id pub-id-type="pmid">9622634</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0925-4773(98)00043-4</pub-id>
        </citation>
      </ref>
      <ref id="B27">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wahl</surname>
              <given-names>LM</given-names>
            </name>
            <name>
              <surname>Corcoran</surname>
              <given-names>ML</given-names>
            </name>
            <name>
              <surname>Mergenhausen</surname>
              <given-names>SE</given-names>
            </name>
            <name>
              <surname>Finbloom</surname>
              <given-names>DS</given-names>
            </name>
          </person-group>
          <article-title>Inhibition of phospholipase activity in human monocytes by IFN-γ blocks endogenous prostaglandin E<sub>2</sub> dependent collagenase production.</article-title>
          <source>J Immunol</source>
          <year>1990</year>
          <volume>144</volume>
          <fpage>3518</fpage>
          <lpage>3522</lpage>
          <pub-id pub-id-type="pmid">2158512</pub-id>
        </citation>
      </ref>
      <ref id="B28">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Corcoran</surname>
              <given-names>ML</given-names>
            </name>
            <name>
              <surname>Stetler-Stevenson</surname>
              <given-names>WG</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>PD</given-names>
            </name>
            <name>
              <surname>Wahl</surname>
              <given-names>LM</given-names>
            </name>
          </person-group>
          <article-title>Interleukin 4 inhibition of prostaglandin E<sub>2</sub> synthesis blocks interstitial collagenase and 92-kDa type IV collagenase/gelatinase production by human monocytes.</article-title>
          <source>J Biol Chem</source>
          <year>1992</year>
          <volume>267</volume>
          <fpage>515</fpage>
          <lpage>519</lpage>
          <pub-id pub-id-type="pmid">1309751</pub-id>
        </citation>
      </ref>
      <ref id="B29">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mertz</surname>
              <given-names>PM</given-names>
            </name>
            <name>
              <surname>DeWitt</surname>
              <given-names>DL</given-names>
            </name>
            <name>
              <surname>Stetler-Stevenson</surname>
              <given-names>WG</given-names>
            </name>
            <name>
              <surname>Wahl</surname>
              <given-names>LM</given-names>
            </name>
          </person-group>
          <article-title>Interleukin 10 suppression of monocyte prostaglandin H synthase-2. Mechanism of inhibition of prostaglandin dependent matrix metalloproteinase production.</article-title>
          <source>J Biol Chem</source>
          <year>1994</year>
          <volume>269</volume>
          <fpage>21322</fpage>
          <lpage>21329</lpage>
          <pub-id pub-id-type="pmid">8063757</pub-id>
        </citation>
      </ref>
      <ref id="B30">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Busiek</surname>
              <given-names>DF</given-names>
            </name>
            <name>
              <surname>Baragi</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Nehring</surname>
              <given-names>LC</given-names>
            </name>
            <name>
              <surname>Parks</surname>
              <given-names>WC</given-names>
            </name>
            <name>
              <surname>Welgus</surname>
              <given-names>HG</given-names>
            </name>
          </person-group>
          <article-title>Matrilysin expression by human mononuclear phagocytes and its regulation by cytokines and hormones.</article-title>
          <source>J Immunol</source>
          <year>1995</year>
          <volume>154</volume>
          <fpage>6484</fpage>
          <lpage>6491</lpage>
          <pub-id pub-id-type="pmid">7759883</pub-id>
        </citation>
      </ref>
      <ref id="B31">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Urade</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Ujihara</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Horiguchi</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Ikai</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Hayaishi</surname>
              <given-names>O</given-names>
            </name>
          </person-group>
          <article-title>The major source of endogenous prostaglandin D<sub>2</sub> production is likely antigen presenting cells.</article-title>
          <source>J Immunol</source>
          <year>1989</year>
          <volume>143</volume>
          <fpage>2982</fpage>
          <lpage>2989</lpage>
          <pub-id pub-id-type="pmid">2509561</pub-id>
        </citation>
      </ref>
      <ref id="B32">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lee</surname>
              <given-names>SH</given-names>
            </name>
            <name>
              <surname>Soyoola</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Chanmugam</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Hart</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Sun</surname>
              <given-names>W</given-names>
            </name>
            <name>
              <surname>Zhong</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Liou</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Simmons</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Hwang</surname>
              <given-names>D</given-names>
            </name>
          </person-group>
          <article-title>Selective expression of mitogen-inducible cyclooxygenase in macrophages stimulated with lipopolysaccharide.</article-title>
          <source>J Biol Chem</source>
          <year>1992</year>
          <volume>267</volume>
          <fpage>25934</fpage>
          <lpage>25938</lpage>
          <pub-id pub-id-type="pmid">1464605</pub-id>
        </citation>
      </ref>
      <ref id="B33">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Endo</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Ogushi</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Sone</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>LPS-dependent cyclooxygenase-2 induction in human monocytes is down regulated by IL-13 but not by IFN-gamma.</article-title>
          <source>J Immunol</source>
          <year>1996</year>
          <volume>156</volume>
          <fpage>2240</fpage>
          <lpage>2246</lpage>
          <pub-id pub-id-type="pmid">8690914</pub-id>
        </citation>
      </ref>
      <ref id="B34">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mellor</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Munn</surname>
              <given-names>DH</given-names>
            </name>
          </person-group>
          <article-title>Tryptophan catabolism and T cell tolerance: immunosuppression by starvation.</article-title>
          <source>Immunol Today</source>
          <year>1999</year>
          <volume>20</volume>
          <fpage>469</fpage>
          <lpage>473</lpage>
          <pub-id pub-id-type="pmid">10500295</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0167-5699(99)01520-0</pub-id>
        </citation>
      </ref>
      <ref id="B35">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Murakami</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Naraba</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Tanioka</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Semmyo</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Nakatani</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Kojima</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Ikeda</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Fueki</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Ueno</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Oh-ishi</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Kudo</surname>
              <given-names>I</given-names>
            </name>
          </person-group>
          <article-title>Regulation of prostaglandin E<sub>2</sub> biosynthesis by inducible membrane-associated prostaglandin E<sub>2</sub> synthase in concert with cyclooxygenase-2.</article-title>
          <source>J Biol Chem</source>
          <year>2000</year>
          <volume>275</volume>
          <fpage>32783</fpage>
          <lpage>32792</lpage>
          <pub-id pub-id-type="pmid">10869354</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.M003505200</pub-id>
        </citation>
      </ref>
      <ref id="B36">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsujii</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>DuBois</surname>
              <given-names>RN</given-names>
            </name>
          </person-group>
          <article-title>Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2.</article-title>
          <source>Cell</source>
          <year>1995</year>
          <volume>83</volume>
          <fpage>493</fpage>
          <lpage>501</lpage>
          <pub-id pub-id-type="pmid">8521479</pub-id>
          <pub-id pub-id-type="doi">10.1016/0092-8674(95)90127-2</pub-id>
        </citation>
      </ref>
      <ref id="B37">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rocca</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Spain</surname>
              <given-names>LM</given-names>
            </name>
            <name>
              <surname>Ciabattoni</surname>
              <given-names>G</given-names>
            </name>
            <name>
              <surname>Patrono</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>FitzGerald</surname>
              <given-names>GA</given-names>
            </name>
          </person-group>
          <article-title>Differential expression and regulation of cyclooxygenase isozymes in thymic stromal cells.</article-title>
          <source>J Immunol</source>
          <year>1999</year>
          <volume>162</volume>
          <fpage>4589</fpage>
          <lpage>4597</lpage>
          <pub-id pub-id-type="pmid">10201998</pub-id>
        </citation>
      </ref>
      <ref id="B38">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gowen</surname>
              <given-names>BB</given-names>
            </name>
            <name>
              <surname>Borg</surname>
              <given-names>TK</given-names>
            </name>
            <name>
              <surname>Ghaffar</surname>
              <given-names>A</given-names>
            </name>
            <name>
              <surname>Mayer</surname>
              <given-names>EP</given-names>
            </name>
          </person-group>
          <article-title>Selective adhesion of macrophages to denatured forms of type I collagen is mediated by scavenger receptors.</article-title>
          <source>Matrix Biol</source>
          <year>2000</year>
          <volume>19</volume>
          <fpage>61</fpage>
          <lpage>71</lpage>
          <pub-id pub-id-type="pmid">10686426</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0945-053X(99)00052-9</pub-id>
        </citation>
      </ref>
      <ref id="B39">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ueno</surname>
              <given-names>R</given-names>
            </name>
            <name>
              <surname>Shimizu</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Kondo</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Hayaishi</surname>
              <given-names>O</given-names>
            </name>
          </person-group>
          <article-title>Activation mechanism of prostaglandin endoperoxide synthetase by hemoproteins.</article-title>
          <source>J Biol Chem</source>
          <year>1982</year>
          <volume>257</volume>
          <fpage>5584</fpage>
          <lpage>5588</lpage>
          <pub-id pub-id-type="pmid">6802818</pub-id>
        </citation>
      </ref>
      <ref id="B40">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Blanco</surname>
              <given-names>JCG</given-names>
            </name>
            <name>
              <surname>Contursi</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Salkowski</surname>
              <given-names>CA</given-names>
            </name>
            <name>
              <surname>DeWitt</surname>
              <given-names>DL</given-names>
            </name>
            <name>
              <surname>Ozato</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Vogel</surname>
              <given-names>SN</given-names>
            </name>
          </person-group>
          <article-title>Interferon regulatory factor (IRF)-1 and IRF-2 regulate interferon γ-dependent cyclooxygenase 2 expression.</article-title>
          <source>J Exp Med</source>
          <year>2000</year>
          <volume>191</volume>
          <fpage>2131</fpage>
          <lpage>2144</lpage>
          <pub-id pub-id-type="pmid">10859338</pub-id>
          <pub-id pub-id-type="doi">10.1084/jem.191.12.2131</pub-id>
        </citation>
      </ref>
      <ref id="B41">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Meade</surname>
              <given-names>EA</given-names>
            </name>
            <name>
              <surname>McIntyre</surname>
              <given-names>TM</given-names>
            </name>
            <name>
              <surname>Zimmerman</surname>
              <given-names>GA</given-names>
            </name>
            <name>
              <surname>Prescott</surname>
              <given-names>SM</given-names>
            </name>
          </person-group>
          <article-title>Peroxisome proliferators enhance cyclooxygenase-2 expression in epithelial cells.</article-title>
          <source>J Biol Chem</source>
          <year>1999</year>
          <volume>274</volume>
          <fpage>8328</fpage>
          <lpage>8334</lpage>
          <pub-id pub-id-type="pmid">10075740</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.274.12.8328</pub-id>
        </citation>
      </ref>
      <ref id="B42">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Pang</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Knox</surname>
              <given-names>AJ</given-names>
            </name>
          </person-group>
          <article-title>Effect of interleukin 1β, tumor necrosis factor-α and interferon-γ on the induction of cyclooxygenase-2 in cultured human airway smooth muscle cells.</article-title>
          <source>Br J Pharmacol</source>
          <year>1997</year>
          <volume>121</volume>
          <fpage>579</fpage>
          <lpage>587</lpage>
          <pub-id pub-id-type="pmid">9179403</pub-id>
        </citation>
      </ref>
      <ref id="B43">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shitahige</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Morita</surname>
              <given-names>I</given-names>
            </name>
            <name>
              <surname>Murota</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <article-title>Existence of endogenous inhibitor(s) of prostaglandin endoperoxide H synthase activities in murine NIH 3T3 fibroblasts.</article-title>
          <source>Prostaglandins Leukot Essent Fatty Acids</source>
          <year>1999</year>
          <volume>61</volume>
          <fpage>97</fpage>
          <lpage>103</lpage>
          <pub-id pub-id-type="pmid">10509864</pub-id>
          <pub-id pub-id-type="doi">10.1054/plef.1999.0077</pub-id>
        </citation>
      </ref>
      <ref id="B44">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dixon</surname>
              <given-names>DA</given-names>
            </name>
            <name>
              <surname>Kaplan</surname>
              <given-names>CD</given-names>
            </name>
            <name>
              <surname>McIntyre</surname>
              <given-names>TM</given-names>
            </name>
            <name>
              <surname>Zimmerman</surname>
              <given-names>GA</given-names>
            </name>
            <name>
              <surname>Prescott</surname>
              <given-names>SM</given-names>
            </name>
          </person-group>
          <article-title>Post-transcriptional control of cyclooxygenase expression.</article-title>
          <source>J Biol Chem</source>
          <year>2000</year>
          <volume>275</volume>
          <fpage>11750</fpage>
          <lpage>11757</lpage>
          <pub-id pub-id-type="pmid">10766797</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.275.16.11750</pub-id>
        </citation>
      </ref>
      <ref id="B45">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sheng</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Shao</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Dixon</surname>
              <given-names>DA</given-names>
            </name>
            <name>
              <surname>Williams</surname>
              <given-names>CS</given-names>
            </name>
            <name>
              <surname>Prescott</surname>
              <given-names>SM</given-names>
            </name>
            <name>
              <surname>DuBois</surname>
              <given-names>RN</given-names>
            </name>
            <name>
              <surname>Beauchamp</surname>
              <given-names>RD</given-names>
            </name>
          </person-group>
          <article-title>Transforming growth factor β1 enhances Ha-ras-induced expression of cyclooxygenase-2 in intestinal epithelial cells via stabilization of mRNA.</article-title>
          <source>J Biol Chem</source>
          <year>2000</year>
          <volume>275</volume>
          <fpage>6628</fpage>
          <lpage>6635</lpage>
          <pub-id pub-id-type="pmid">10692471</pub-id>
          <pub-id pub-id-type="doi">10.1074/jbc.275.9.6628</pub-id>
        </citation>
      </ref>
      <ref id="B46">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fernando</surname>
              <given-names>LP</given-names>
            </name>
            <name>
              <surname>Fernando</surname>
              <given-names>AN</given-names>
            </name>
            <name>
              <surname>Ferlito</surname>
              <given-names>F</given-names>
            </name>
            <name>
              <surname>Halushka</surname>
              <given-names>PV</given-names>
            </name>
            <name>
              <surname>Cook</surname>
              <given-names>JA</given-names>
            </name>
          </person-group>
          <article-title>Suppression of Cox-2 and TNF-alpha mRNA in endotoxin tolerance: effect of cycloheximide, actinomycin D and oakadaic acid.</article-title>
          <source>Shock</source>
          <year>2000</year>
          <volume>14</volume>
          <fpage>128</fpage>
          <lpage>133</lpage>
          <pub-id pub-id-type="pmid">10947155</pub-id>
        </citation>
      </ref>
      <ref id="B47">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Paik</surname>
              <given-names>JH</given-names>
            </name>
            <name>
              <surname>Ju</surname>
              <given-names>JH</given-names>
            </name>
            <name>
              <surname>Boudreau</surname>
              <given-names>MD</given-names>
            </name>
            <name>
              <surname>Hwang</surname>
              <given-names>DH</given-names>
            </name>
          </person-group>
          <article-title>Two opposing effects of nonsteroidal anti-inflammatory drugs on the expression of the inducible cyclooxygenase. Mediation through different signaling pathways.</article-title>
          <source>J Biol Chem</source>
          <year>2000</year>
          <volume>275</volume>
          <fpage>28173</fpage>
          <lpage>28179</lpage>
          <pub-id pub-id-type="pmid">10866999</pub-id>
        </citation>
      </ref>
      <ref id="B48">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Oshima</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Dinchuk</surname>
              <given-names>JE</given-names>
            </name>
            <name>
              <surname>Kargman</surname>
              <given-names>SL</given-names>
            </name>
            <name>
              <surname>Oshima</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Hancock</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Kwong</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Trzaskos</surname>
              <given-names>JM</given-names>
            </name>
            <name>
              <surname>Evans</surname>
              <given-names>JF</given-names>
            </name>
            <name>
              <surname>Taketo</surname>
              <given-names>MM</given-names>
            </name>
          </person-group>
          <article-title>Suppression of intestinal polyposis in Apc delta716 knockout mice by inhibition of cyclooxygenase 2 (COX-2).</article-title>
          <source>Cell</source>
          <year>1996</year>
          <volume>87</volume>
          <fpage>803</fpage>
          <lpage>809</lpage>
          <pub-id pub-id-type="pmid">8945508</pub-id>
          <pub-id pub-id-type="doi">10.1016/S0092-8674(00)81988-1</pub-id>
        </citation>
      </ref>
      <ref id="B49">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Williams</surname>
              <given-names>CS</given-names>
            </name>
            <name>
              <surname>Tsujii</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Reese</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Dey</surname>
              <given-names>SK</given-names>
            </name>
            <name>
              <surname>DuBois</surname>
              <given-names>RN</given-names>
            </name>
          </person-group>
          <article-title>Host cyclooxygenase modulates carcinoma growth.</article-title>
          <source>J Clin Invest</source>
          <year>2000</year>
          <volume>105</volume>
          <fpage>1589</fpage>
          <lpage>1594</lpage>
          <pub-id pub-id-type="pmid">10841517</pub-id>
        </citation>
      </ref>
      <ref id="B50">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mellor</surname>
              <given-names>AL</given-names>
            </name>
            <name>
              <surname>Sivakumar</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Chandler</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Molina</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Mao</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Munn</surname>
              <given-names>DH</given-names>
            </name>
          </person-group>
          <article-title>Tryptophan catabolism suppresses T cell induced inflammation and B-cell independent complement activation during pregnancy.</article-title>
          <source>Nature Immunol</source>
          <year>2001</year>
          <volume>2</volume>
          <fpage>64</fpage>
          <lpage>68</lpage>
          <pub-id pub-id-type="pmid">11135580</pub-id>
          <pub-id pub-id-type="doi">10.1038/83183</pub-id>
        </citation>
      </ref>
      <ref id="B51">
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kousakoff</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Fehling</surname>
              <given-names>HJ</given-names>
            </name>
            <name>
              <surname>Lemeur</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Benoist</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Mathis</surname>
              <given-names>D</given-names>
            </name>
          </person-group>
          <article-title>A vector driving the expression of foreign cDNAs in the MHC classII-positive cells of transgenic mice.</article-title>
          <source>J Immunol Meth</source>
          <year>1993</year>
          <volume>166</volume>
          <fpage>287</fpage>
          <lpage>291</lpage>
          <pub-id pub-id-type="doi">10.1016/0022-1759(93)90370-M</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>

</metadata></record></ListRecords></OAI-PMH>